1 - 50 of 430
suppliers found for
Rat Leptin RIA kit
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-P7482-10 μg, 10 μg, USD $75.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: Plasma leptin concentration was assayed using a multispecies leptin RIA kit (Cat#XL-85K, Millipore, Billerica, Massachusetts, USA). The validity test for reindeer showed a linear correlation between the label and sample concentration ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.2021096118Quote: ELISA for serum leptin was conducted using a mouse/rat Leptin Quantikine ELISA Assay kit (R&D Systems, MOB00) at a concentration of 1:2 in LD mice ... -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: Plasma Leptin levels were measured by mouse mouse Leptin ELISA kit (Crystal Chem) according to the manufacturer’s instructions. -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2020Quote: ... CORT levels were measured using a radioimmunoassay (RIA) kit according to the manufacturer protocol (ImmuChemTM Double Antibody Corticosterone 125I RIA, MP Biomedicals, USA). -
Corning
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... 96 well EIA/RIA plates (Corning) were coated overnight at 4°C with anti-isotype-specific antibodies (BD Pharmingen ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... Frozen aliquots were thawed on ice and analyzed using a Leptin Rat ELISA kit (Invitrogen). -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: Leptin concentration within all collected samples was determined using the Human Leptin Standard ABTS ELISA Development Kit (PeproTech #900-K90) and ABTS ELISA Buffer Kit (PeproTech #900-K00 ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.Cited in MetAP2 inhibition reduces food intake and body weight in a ciliopathy mouse model of obesitybioRxiv - Pharmacology and Toxicology 2019, published in JCI Insight doi: 10.1172/jci.insight.134278Quote: ... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions. -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... Serum 17β-estradiol levels in female rats and serum testosterone levels in male rats were assayed using commercially available radioimmunoassay (RIA) kits from Beckman Coulter (Brea ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017Quote: ... Rat” Ribo-Zero kit (Illumina) which is also recommended for insect rRNA depletion ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... Leptin Receptor -Alexa 647 (BD Biosciences Cat# 564376 ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... cAMP content in TCA extracts was determined by radioimmunoassay (RIA) (83) and normalized to protein [(determined using a dyebinding protein assay (Bio-Rad)] ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... we used heterozygous P23H rats obtained by crossing homozygous RHOP23H rats with RHOWT rats (CDH IGS Rat; Charles River, Germany). Animals were housed in the Institute for Ophthalmic Research animal facility under standard white cyclic lighting ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017, published in Traffic doi: 10.1111/tra.12507Quote: ... rat cDNA was generated from PC12 cells using QuantiTect Reverse transcription kit (Qiagen) and an anchored Oligo(dT ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and rat anti-HA (rat mab 3F10; Roche, 1:200) antibodies diluted in blocking buffer ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... sections were first stained with rat anti-mouse c-Kit (BioLegend, 135102) followed with a goat anti-rat-Cy3 (Jackson Immunoresearch ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Human Molecular Genetics doi: 10.1093/hmg/ddz058Quote: ... or rat (Dako) antibodies were used at a dilution of 1:5000 ... -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Envigo RMS
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... All rats were fed rat chow (Envigo Teklad rodent diet 8604) and water ad libitum ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... using the Amaxa Rat Neuron Nucleofector Kit (Lonza Cologne AG ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... rat anti-RFP (ChromoTek) 1:1000 ... -
Bio X Cell
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... Rat-IgG (2A3, BioXcell) and Hamster-IgG (Life Technologies ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Bound rat antibodies were detected with FITC-conjugated goat anti-rat IgG (Jackson ImmunoResearch). -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Journal of Clinical Oncology doi: 10.1200/JCO.2019.37.7_suppl.554Quote: ... Primary antibodies to leptin (dilution 1:100; SC-842, SANTA CRUZ, Dallas, TX, USA), adiponectin (dilution 1:100 ... -
Lucigen
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in eLife doi: 10.7554/eLife.49708Quote: ... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... pLE1-firefly luciferase was generated by cloning 115bp leptin enhancer 1(LE1)(GAGAACACTTAACAGCAAAGGTTAATCTTTGAAGTCCCTAAAGATTTGAACTTTCCGCAGAATTGGCTGCAGCGTCTAGTGGGTTAGAGTCTAATTGGAGTAGAGCAGAAGCAAG) into pGL4.27 (Promega) between XhoI and HindIII sites ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in Aberrant claudin-6–adhesion signal promotes endometrial cancer progression via estrogen receptor αbioRxiv - Cancer Biology 2020Quote: ... Histofine SAB-PO kit for rabbit (Nichirei) or VECTASTAIN Elite ABC HRP Kit for rat (VECTOR LABORATORIES) was used for 3’,3’-diaminobenzidine (DAB ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... -anti-rat (Cell Signaling Technology), -anti-mouse (EMD Millipore ... -
Cedarlane
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Scientific Reports doi: 10.1038/s41598-020-67755-3Quote: ... Secreted insulin and insulin content were measured by radioimmunoassay (Rat insulin RIA Kit, Cedarlane, Burlington, ON, CA) or using the Mouse Ultrasensitive Insulin ELISA kit (ALPCO ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1806366115Quote: ... Leptin-luciferase reporter BACs were used to generate transgenic animals in the inbred FVB N/J background (Jackson Lab) using common pronuclear injection techniques (17 ... -
Takara Bio
No products found because this supplier's products are not listed.Cited in Rac-dependent signaling from keratinocytes promotes differentiation of intradermal white adipocytesbioRxiv - Cell Biology 2018, published in Journal of Investigative Dermatology doi: 10.1016/j.jid.2019.06.140Quote: Rat primary white pre-adipocytes and rat primary brown pre-adipocytes were purchased from TaKaRa Bio Inc ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... mouse and rat (Miltenyi Biotec). Cardiomyocytes and non-cardiomyocytes were separated by Percoll gradient centrifugation ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... donkey anti-rat HRP from GE Healthcare, goat anti-guinea pig HRP from Santa Cruz ... -
Bethyl
No products found because this supplier's products are not listed.Cited in Cdk1-dependent destabilization of long astral microtubules is required for spindle orientationbioRxiv - Cell Biology 2020Quote: ... donkey anti-rat Alexa488 (Bethyl; A110-337D2, donkey anti-rat Alexa594 (Bethyl; A110-337D4), donkey anti-rabbit Alexa488 (Thermofisher ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... anti-rat IgG2a-AF488 (SouthernBiotech), and anti-rat IgG2b-AF647 (BioLegend) ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... anti-rat (IRDye® 800 CW Goat anti-Rat IgG [H + L], LI-COR, 925-32219, 1:10.000) and anti-rabbit (IRDye ® 800 CW Goat anti-Rabbit IgG ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... rat anti-OLLAS (1:2000; Novus Biological); rabbit anti-GFP (1:200 ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in Cell doi: 10.1016/j.cell.2020.03.062Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Genetics 2021Quote: Add normal rat serum from the EasySep Mouse T-cell Isolation Kit (StemCell Technologies) and Isolation Cocktail ... -
Dianova
No products found because this supplier's products are not listed.Cited in Cysteine crosslinking in native membranes establishes the transmembrane architecture of Ire1bioRxiv - Biochemistry 2021Quote: ... anti-rat-HRP (Dianova). All strains and plasmids used in this study are listed in Suppl ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... RNA from rat lungs was isolated from the lysate using Direct-zol RNA MiniPrep (Zymo Research), according to the manufacturer’s protocol ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: Rat RVLM sections were stained using a TUNEL kit (Biotium, Fremont, CA) according to the manufacturer’s protocols ... -
BrainBits
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2017, published in ACS Nano doi: 10.1021/acsnano.8b00867Quote: ... E18 rat hippocampus (Brainbits) were dissociated with papain and seeded on a poly-D-lysine (Sigma-Aldrich ... -
Origene Technologies
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... and siRNA against rat NCLX (SL8B1 gene) was purchased from OriGene (SLC8B1 Trilencer-27 Rat siRNA). -
PerkinElmer
No products found because this supplier's products are not listed.Cited in DNA Methylation Repels Binding of HIF Transcription Factors to Maintain Tumour ImmunotolerancebioRxiv - Genomics 2020Quote: ... These steps were repeated starting from blocking for the second staining with primary antibody rat anti-CD8a 1:300, secondary antibody goat anti-rat (MP-7444, Vector) and opal 690 (fp1497, PerkinElmer) and the third staining with rat anti-CD45 1:1,000 ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... rat tail was purchased from Enzo Life Sciences, Inc ... -
CisBio
No products found because this supplier's products are not listed.Cited in Light effects on circadian and homeostatic regulation: alertness increases independent of time awakebioRxiv - Neuroscience 2020Quote: ... Cortisol concentrations were detected with RIA analysis (CORT-C2; Cisbio, Bioassays ...