-
No products found
because this supplier's products are not listed.
Elaheh Movahed, et al.,
bioRxiv - Immunology 2022
Quote:
... Those samples were submitted for Lyme disease serology and subjected to two-tiered testing consisting of (Tier 1) a C6 peptide screen (Immunetics®; C6 Lyme ELISA™) or Enzyme Linked Fluorescent Assay (ELFA ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Juan Feng, et al.,
bioRxiv - Immunology 2021
Quote:
Heavy and light chain V region cDNA sequences of mAbs 2/6.14 and 2/1.12 were determined by Syd Labs (Natick, MA). The mAbs each have γ1 heavy and κ light chains and unique V regions as shown by BLAST searches ...
-
No products found
because this supplier's products are not listed.
Víctor M. Hernández-Rocamora, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The protein was labelled with Dy647-maleimide probe (Dyomics, Germany) following instructions from the manufacturer ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Oh Sung Kwon, et al.,
bioRxiv - Cell Biology 2020
Quote:
... To repress protein synthesis 100 μg/ml of cycloheximide (TOKU-E) and 300 μM of puromycin (InVivoGen ...
-
No products found
because this supplier's products are not listed.
Gozde S. Demirer, et al.,
bioRxiv - Plant Biology 2022
Quote:
... DNA sequences for these protein coding regions were synthesized by Bionexus™ into a GATEWAY™ compatible vector pUC57 with point mutations made to convert a proline to a lysine in Solyc04g079980 (P243-> L ...
-
No products found
because this supplier's products are not listed.
Camila Ribeiro, et al.,
bioRxiv - Plant Biology 2020
Quote:
... plants were painted with a 2% glufosinate-ammonium (Bio-world), and non-transgenic segregants were removed (56) ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
Julia Bitencourt, et al.,
bioRxiv - Immunology 2021
Quote:
... The antigens used were purified protein derivative (PPD) from M.tb (Statens Serum Institut (SSI), Denmark ...
-
No products found
because this supplier's products are not listed.
Du-Hwa Lee, et al.,
bioRxiv - Plant Biology 2022
Quote:
... RealHelixTM qPCR kit (NANOHELIX; Korea), and the StepOnePlus Realtime PCR System (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Chandrashekhar D. Borkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... retrogradely transported beads (0.2 μl, 1:2 diluted with saline, Lumafluor Inc., Durham, NC) were stereotaxically injected into the respective brain regions ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Shima Shahbaz, et al.,
bioRxiv - Immunology 2020
Quote:
... The SARS-CoV-19 spike receptor binding domain protein was purchased from VIROGEN (Cat#00224-V), conjugated with dye using Fluorescent protein labeling kit according to the manufacturing protocol (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Rubika Balendra, et al.,
bioRxiv - Neuroscience 2022
Quote:
Poly(PR) 20-mer dipeptide repeat protein with a C-terminal FLAG tag was purchased from CSBio and verified by mass spectrometry ...
-
No products found
because this supplier's products are not listed.
Qianying Zuo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
IN SITE Metastasis Kit (Xylyx Bio, Inc., NY) containing TissueSpec Bone (MTSBN101) ...
-
No products found
because this supplier's products are not listed.
Amy R. Rappaport, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were incubated with anti-nucleocapsid protein primary antibody cocktail (clones HM1056 and HM1057) (EastCoast Bio, North Berwick, ME) for 60 minutes at 37°C (Battelle Memorial Institute ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
SL Plasil, A Seth, GE Homanics,
bioRxiv - Genetics 2020
Quote:
... Cas9 Nuclease V3 protein (IDT, #1081058) with a Bio-Rad Gene-Pulser Xcell in a 1mm-gap slide electrode (Protech International, #501P1-10) using square-wave pulses (five repeats of 3msec 25V pulses with 100msec interpulse intervals) ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Jeong-Kyu Han, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The membranes were visualized using an ECL detection kit (SurModics, MN, USA).
-
No products found
because this supplier's products are not listed.
Anne Tersteegen, et al.,
bioRxiv - Immunology 2021
Quote:
Total DNA was isolated from tissues using a DNA isolation kit (Genekam) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Andrew S. Bray, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the suspension serially diluted and plated onto LB agar plates (Fisher, BP9745-2) In between sampling the plates were sealed with parafilm (Bemis, PM-999) and placed in the dark at room temperature.
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Chan Cao, et al.,
bioRxiv - Biophysics 2023
Quote:
... EBCs were lysed and further treated using the Hemovoid kit (Biotech Support Group), aiming to remove hemoglobin (the most abundant protein in RBCs ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HA concentration was confirmed in the extracted samples with a Hyaluronic Acid test kit (Corgenix Specialists in ELISA & IVD Diagnostic Technology ...
-
No products found
because this supplier's products are not listed.
Yuqian Jiang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... A temperature-controlled oil bath (Instatherm® Economy Bath/Controller Kit, Ace Glass, Inc., VWR, USA) equipped with a type J thermocouple temperature sensor was employed to control the heat treatment temperature ...
-
No products found
because this supplier's products are not listed.
Veronica Ferrucci, et al.,
bioRxiv - Genetics 2020
Quote:
... Real-time RT-PCR was performed using ‘RealQquality RQ-2019-nCoV’ kits (Ab Analitica; IVD approved) for detection of the RdRp and E genes (from the SarsCov2 N gene) ...
-
No products found
because this supplier's products are not listed.
Kristina Haslinger, et al.,
bioRxiv - Biochemistry 2020
Quote:
... we used the TR-FRET Bridge-It® S-Adenosyl Methionine (SAM) Fluorescence Assay Kit from Mediomics LLC (St ...
-
No products found
because this supplier's products are not listed.
Bettina Budeus, et al.,
bioRxiv - Immunology 2022
Quote:
... IGHV gene rearrangements were amplified using the LymphoTrack IGH FR1 Assay kit (InvivoScribe, San Diego, CA, USA). Amplified DNA was processed for HTSeq according to the LymphoTrack protocol ...
-
No products found
because this supplier's products are not listed.
Hongji Yan, et al.,
bioRxiv - Bioengineering 2019
Quote:
The sialic acid removal assay was conducted by using Neuraminidase immobilized on slurry (GlycoCleave Neuraminidase kit, GALAB technologies). Briefly ...