-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
PC12 cell or rat liver gDNAs was isolated using the TIANamp blood DNA kit (TIANGEN Biotech, DP304-02) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ranjani Murali, Robert B. Gennis, James Hemp,
bioRxiv - Biochemistry 2021
Quote:
Oxygen reductase activity was measured using the Mitocell Miniature Respirometer MT200A (Harvard Apparatus). 5 mM DTT and 350 μM Q1 were used as electron donors to measure oxygen reduction by C.maquilingensis cydAA’ and E.coli cytochrome bd ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
A. Prunet, et al.,
bioRxiv - Biophysics 2020
Quote:
... Membranes were then incubated with monoclonal antibodies against Cyclin B1 (PC133, Calbiochem) and GAPDH (#8884 ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Yahaya A. Yabo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an Opal 3-Plex Manual Detection Kit (Akoya Biosciences) was used following the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Kristina Vaeth, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-rat-HRP (Dianova). All strains and plasmids used in this study are listed in Suppl ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ramile Dilshat, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
No products found
because this supplier's products are not listed.
Zhadyrassyn Nurbekova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Abscisic aldehyde was purchased from Toronto Research Chemicals (www.trc-canada.com).
-
No products found
because this supplier's products are not listed.
Yongrong Liao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit polyclonal anti-Cyclin B1 (GeneTex, GTX100911), rabbit polyclonal anti-FXR2 (Proteintech ...
-
Rat Aflatoxin B1 Aldehyde Reductase Member 3 (AKR7A3) ELISA Kit is an ELISA Kit for the in vitro...
Cat# abx555930-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Lei Chang, et al.,
bioRxiv - Genomics 2019
Quote:
... STORM imaging of lamin B1 was done on N-STORM (Nikon, Japan)
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Nadab H. Wubshet, et al.,
bioRxiv - Cell Biology 2024
Quote:
... spheroids were encapsulated in collagen hydrogel consisting of 3 mg/mL rat-tail collagen (Advanced BioMatrix). The encapsulated spheroids were cultured in custom inserts fabricated by Space Tango ...
-
No products found
because this supplier's products are not listed.
Frederic Li Mow Chee, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were resuspended in 2–3 mg/ml rat-tail collagen I in RM+ medium and seeded on 23-mm FluoroDish cell culture dishes (World Precision Instruments). The collagen with embedded cells was allowed to set at 37°C until collagen contraction was observed (∼30 min) ...
-
No products found
because this supplier's products are not listed.
Robert Bucki, et al.,
bioRxiv - Biophysics 2022
Quote:
... rat tail 5mg/ml (Ibidi) were diluted on ice to 1.5mg/ml with 6.67% of 5x DMEM (Fisher scientific) ...
-
No products found
because this supplier's products are not listed.
Pedro J. del Rivero Morfin, et al.,
bioRxiv - Physiology 2023
Quote:
Culturing kits for rat hippocampi at embryonic age 18 were procured from Transetyx Tissue by BrainBits (Tranetyx Inc). Neurons were isolated from hippocampi using papain in Ca2+-free medium (2 mg/mL ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3-micron beads (Polysciences Inc) were resuspended in 0.1 M Borate and incubated with human IgG at 4°C overnight while rotating ...
-
Decyl aldehyde (Decanal, Capraldehyde, Decanaldehyde) is a naturally occuring organic compound...
Cat# S5376, SKU# S5376-25ul,
25ul, $97.00
Ask
Giovanni C. Forcina, et al.,
bioRxiv - Cell Biology 2021
Quote:
A 261-member bioactive compound library were obtained from Selleck Chemicals (Cat# L2000), formatted as described previously (6) ...
-
No products found
because this supplier's products are not listed.
S. Kasra Tabatabaei, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... Both B1 and B2 were purchased from TriLink Biotechnologies in form of triphosphates (https://www.trilinkbiotech.com/2-amino-2-deoxyadenosine-5-triphosphate-n-2003.html and https://www.trilinkbiotech.com/5-hydroxymethyl-2-deoxycytidine-5-triphosphate.html) ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Yusuke Ohno, et al.,
bioRxiv - Cell Biology 2023
Quote:
... A mixture of the crude aldehyde and triethyl phosphonoacetate (988 μL, 4.98 mmol; Tokyo Chemical Industry) was treated with 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU ...
-
No products found
because this supplier's products are not listed.
Raphaëlle Luisier, et al.,
bioRxiv - Neuroscience 2022
Quote:
Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Muscles were incubated overnight at 4°C with a rat IgG2a anti-MAC-2 (Galectin-3) antibody (1:250; clone M3/38; Cedarlane, cat# CL8942AP), then 2h at RT with a rabbit IgG anti-S100β antibody (1:250 ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... a MACH 3 Rabbit HRP Polymer Detection kit (Biocare Medical # M3R531H) or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H ...
-
No products found
because this supplier's products are not listed.
Yolanda Campos-Jurado, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rats were implanted stereotaxically (Stoelting, USA) with bilateral vertical concentric-style microdialysis probes containing 2 mm of active membrane (Hospal AN69 ...
-
No products found
because this supplier's products are not listed.
Aurelie Schwartzentruber, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The ELISA was read on a PheraStar plate reader (BMG Labtech) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Anja van Benthem, et al.,
bioRxiv - Neuroscience 2023
Quote:
... After confirming its affinity (Eurogentec; Peptide: 1712973, Rat SYR576) through ELISA ...
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 3 kDa MWCO concentrator (Sartorius), and the protein concentration was estimated using a BCA assay.
-
No products found
because this supplier's products are not listed.
Matthew G. Zimmerman, et al.,
bioRxiv - Microbiology 2019
Quote:
... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...
-
No products found
because this supplier's products are not listed.
Jianing Song, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ubiquitin aldehyde (U-201, Boston Biochem), creatine phosphokinase from rabbit muscle (C3755 ...
-
No products found
because this supplier's products are not listed.
Kaspar Matiasek, et al.,
bioRxiv - Microbiology 2022
Quote:
... before 175 µl B1 buffer (Covaris) were added ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
... 40 nM of each labeled Plexin construct was mixed with a serial dilution of unlabeled GTPases or Plexin-B1 in 0.2 mL micro reaction tubes (NanoTemper) and then transferred to premium capillaries (NanoTemper) ...
-
No products found
because this supplier's products are not listed.
Xing-Hua Liao, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cardiac myocytes were isolated from day 1-3 Sprague-Dawley rat pups as described previously.(11–13) COS7 cells were bought from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
Cat# HY-N6615-1 mg,
1 mg, USD $110.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Sebastian A. Pace, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Rats were placed in plastic decapicones (Braintree Scientific, Braintree, MA) and a small window was cut in the plastic to expose the cannula as previously described (Wallace & Myers ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...