-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Adriana C. Camarano, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-TH (1:1000; 657012, Calbiotech); chicken anti-TH (1:1000 ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... transfected Jurkat cells and co-culture with HLA-unenhanced neurons or in presence of a blocking anti-HLA ABC antibody (W6/32, AffinityImmuno). Luminescence was measured with a Multimode Microplate Reader (BioTek Synergy) ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Anne Slavotinek, et al.,
bioRxiv - Genetics 2020
Quote:
... Neomycin phosphotransferase II (NPTII) expressed from NeoR cassette on pcDNA3-Exosc5 vectors was detected with anti-NPTII monoclonal antibody (1:1000; Cell Applications, Inc.). Primary antibodies were detected using goat secondary antibodies coupled to horseradish peroxidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Olivia M. S. Carmo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit α0801 (1:1000, gift from T. de Koning Ward and P. Gilson [9]), rabbit αMESA (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
M. Julhasur Rahman, et al.,
bioRxiv - Microbiology 2021
Quote:
... the RK13 cells we used were confirmed to be of European rabbit (Oryctolagus cuniculus) origin by PacBio sequencing (ArrayExpress accession ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Bálint András Barta, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The antibodies were stained by incubation with 100μL of substrate solution (Neogen) containing 3,3′,5,5′-tetramethylbenzidine (TMB ...
-
No products found
because this supplier's products are not listed.
Jorge Mauricio Reyes-Ruiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Monoclonal antibodies were diluted in protein array blocking buffer (GVS, Sanford, ME, USA) to a final concentration of 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Michael P. Motley, et al.,
bioRxiv - Immunology 2020
Quote:
Antibodies were produced weekly over six months from respective hybridomas grown in CELLine (Wheaton) flasks fed with High-Glucose DMEM + 10% NCTC media and 1x Penicillin-Streptomycin and 1x Non-Essential Amino Acids ...
-
No products found
because this supplier's products are not listed.
Brunda Ganneru, et al.,
bioRxiv - Immunology 2020
Quote:
... and New Zealand White (NZW) rabbits (in vivo models) were sourced from CPCSEA approved vendor and strains of Salmonella typhimurium (Moltox, Switzerland) for in vitro assay ...
-
No products found
because this supplier's products are not listed.
Soo Jeong Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or Flamma 648 conjugated goat anti-rabbit IgG (Cat# A-11008, RRID: AB_143165 and Cat# A-11011, RRID: AB_143157, Molecular Probes and Cat# RSA1261, BioActs, Incheon, South Korea) and Alexa Fluor 488 or 568 conjugated goat anti-mouse antibodies (Cat# A-11004 ...
-
No products found
because this supplier's products are not listed.
Yuichi Tsuchiya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The messenger RNA was purified from the total RNA of the spleen and bone marrow cells of immunized rabbits using the NucleoTrap mRNA kit (Macherey-Nagel, 740655) and according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Lebogang N. Maruma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Signalling Technology antibodies and Promega luminometry kits were procured from Anatech (Johannesburg, South Africa). All other reagents were purchased from Merck (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Priyamvada Acharya, et al.,
bioRxiv - Immunology 2020
Quote:
... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Yeon-Jee Kahm, Uhee Jung, Rae-Kwon Kim,
bioRxiv - Cancer Biology 2023
Quote:
... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
João L. Pereira, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Tris-buffered saline with 0.1% Tween 20 was used for washing and antibody incubation as well as membrane blocking with 5% bovine serum albumin (cat. no. MB04602, NZYTech). The chemiluminescent signals were acquired by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (cat ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
Recombinant Rabbit BCMA Protein, fused to His tag, was expressed in HEK293.
Cat# TNFRSF17-02R,
10ug , USD $198
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...