-
No products found
because this supplier's products are not listed.
Arumoy Chatterjee, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The deuterated internal standards 2-(4-Hydroxyphenyl)ethyl-1,1,2,2-d4-amine HCl and beta-Hydroxytyramine (α-d2, β-d1) HCl were supplied by Medical Isotopes, Inc ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Aldo E. García-Guerrero, et al.,
bioRxiv - Microbiology 2024
Quote:
... Membranes were blocked at room temperature for 1 hour in 5% skim milk/PBS and probed overnight at 4°C with 1:1000 dilutions of rabbit anti-HSP60 (Novus NBP2-12734) and goat anti-GFP (Antibodies.com A121560) antibodies ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% of the KH-103 in Captisol/DMSO was formulated in 20% Solutol (GLPBIO) in 0.9% sterile saline (Moltox) (w:v ...
-
No products found
because this supplier's products are not listed.
Bijoya Sen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Blood was collected from healthy donors (N=5) and PBMCs were isolated using Lymphoprep™ (Alere Technologies AS, Oslo, Norway) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Minsuk Kong, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Increasing ratios (multiplicities of incubation ranging from 20 to 150) of SSHELαHER2 (labeled with AlexaFluor647) were incubated with 5 × 105 cells/ml in siliconized tubes (G-tubes, Bio Plas Inc.) for 1 h at 37 °C with gentle inversion ...
-
No products found
because this supplier's products are not listed.
Laura Martinez-Ruiz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Tumor pieces were digested using 5–10 mL of a 2.5 mg/mL Collagenase NB4 standard (S1745401 Nordmark Biochemicals, Uetersen, Germany) solution in PBS + 3 mM CaCl2 for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Sayak Mukhopadhyay, et al.,
bioRxiv - Microbiology 2024
Quote:
We washed the cell culture twice in motility buffer (MB) at 1500 g for 5 min in a centrifugation unit (Scilogex SCT412). The supernatant was discarded ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Le Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Primary antibodies with final concentrations used for immunofluorescence staining: rabbit anti-SCGB1A1 polyclonal antibody [5 mg/ml] (WRAB-3950, Seven Hills Bioreagents), mouse anti-FOXJ1 monoclonal antibody [8 mg/ml] (14-9965-80 ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Rebecca C.S. Edgar, et al.,
bioRxiv - Microbiology 2023
Quote:
... Venous blood (5 mL) was collected by venipuncture and after removal of host white blood cells using Plasmodipur filters (EuroProxima B.V., The Netherlands), packed infected red blood cells (iRBCs ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Ken Shirato, Jun Takanari, Takako Kizaki,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the cells were co-treated with the indicated concentrations of ETAS®50 or dextrin and 100 ng/mL of SARS-CoV-2 spike recombinant protein S1 subunit (Arigo Biolaboratories, Hsinchu City, Taiwan) for 1 to 24 h ...
-
Cat# CDC10-0289,
1 kg, Inquire for price
No citation found on bioRxiv
-
The RGPD1 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 3945801.0,
1.0 μg DNA, NM_001024457 (Human), Inquire
No citation found on bioRxiv
-
Cat# ACM556050487,
Inquire
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Catalog Number: B2010466 (1 mg)
8-Hydroxy-2′-deoxyguanosine (8-Oxo-dG) is a highly pure (> 98%)...
Cat# B2010466,
USD $350.0
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# BHVs-013,
1 vial, USD $387
No citation found on bioRxiv
-
Size: 8"x4"
Carbon Content: 97%
Thickness: 25 micrometers
Density: 2 g/cm3
Thermal Conductivity:...
Cat# GRA-194,
5 sheets, USD $530.0
No citation found on bioRxiv
-
Human ORM2 C13 and N15 (Arg and Lys) Stable Isotope Labeled Peptide standards for MS research....
Cat# CPILP18042,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
SeedEZ 3D cell culture scaffold, sample 5 cm x 10 cm
Cat# SC-S510-0001,
1 unit, $102.00
No citation found on bioRxiv