-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lungs were homogenized RIPA buffer with protease inhibitor using a tissue dissociator (GentleMacs Dissociator Miltenyi Biotec). Homogenates were then centrifuged at 10,000 rpm and 4°C and the supernatants were collected and prepared for either Lc3 or Atg16L1 detection as described above.
-
No products found
because this supplier's products are not listed.
Noémie Gaudin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and the LRRCC1 fragments were recovered by Tev protease cleavage and dialyzed before rabbit immunization (Covalab). Antibodies were affinity-purified over the corresponding GST-LRRCC1 fusion bound to Affi-Gel 10 resin (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Francesco Maura, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... followed by protease treatment at 40º C for 10-15 minutes (Abbott Molecular, Des Plaines, IL), then by dehydrating 2 minutes each in a serios of 70% ...
-
No products found
because this supplier's products are not listed.
Emelyne Teo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 1X Protease inhibitors and 1mM PMSF) and homogenized using a Bead Beater (Benchmark Scientific, Edison, USA). To obtain the detergent-soluble protein ...
-
No products found
because this supplier's products are not listed.
Charlotte A. Dawson, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Serine protease (SVSP) activity was determined using an absorbance-based Chromogenic S-2288 assay (Chromogenix, 82085239). Venoms were diluted to 0.066 mg/mL and 15 μL added per well in quadruplicate to a 384-well plate before incubation for 3 mins at 37 °C ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Amanda L. Peiffer, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Active protein was quantified by titrating in the known active site protease inhibitor FPR-CMK (Haematologic Technologies). To determine the KM the initial fluorescence data ...
-
No products found
because this supplier's products are not listed.
David Peeney, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 15 minutes of Protease III (ACD) at 40°C using the Bond RX auto-stainer (Leica Biosystems), and 1:750 dilution of TSA-Cyanine 5 Plus (AKOYA ...
-
No products found
because this supplier's products are not listed.
Thi Tuyet Trinh Phan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and 0.5% sodium deoxycholate) supplemented with complete protease and phosphatase inhibitor cocktails (Fivephoton Biochemicals, San Diego, CA, USA). Cell suspension was subsequently incubated on ice for 10 min and then vortexed vigorously for 5 sec ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Wei Gu, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... about 50 μl of pelleted cross-linked cells were resuspended in 350 μl sarkosyl lysis buffer (0.25% sarkosyl, 1 mM DTT and Protease Inhibitor Cocktails in 0.3M RIPA buffer and sonicated at 60% amplification by a tip sonicator (125W ...
-
No products found
Larissa Krüger, et al.,
bioRxiv - Microbiology 2023
Quote:
... and the tag was removed with the TEV protease (ratio 10:1 w/w) during overnight dialysis (Biodesign™ Cellulose Dialysis Tubing Roll ...
-
No products found
Federica Scotto di Carlo, et al.,
bioRxiv - Cell Biology 2022
Quote:
Total cell lysates (RPE1, MC3T3) were isolated using RIPA buffer supplemented with 1:100 protease (Applied Biological Materials, G135). Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... of 3.2 M guanidine hydrochloride/1.6% formic acid prior to inline digest across a pepsin/protease XIII column (NovaBioAssays) and Nepenthesin 1 column (Phenomenex) using a 10-minute 8-38% acetonitrile gradient (200 ml/min ...
-
No products found
because this supplier's products are not listed.
Luis F. Garcia-Alles, et al.,
bioRxiv - Biochemistry 2019
Quote:
... protein tags were removed by incubation overnight at 25°C with turbo TEV protease (GenWay, 5 μg/mL final) in 50 mM Tris pH 8.0 / 300 mM NaCl /2 mM DTT/ 1 mM EDTA ...
-
No products found
because this supplier's products are not listed.
Maria Camila Fetiva, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 150 mM NaCl and 0.5 mM spermidine containing protease inhibitor) and captured with 20 μl conacavallin A magnetic beads (Polyscience). Cells were resuspended with antibody buffer (wash buffer with 0.005% digitonin and 2 mM EDTA ...
-
No products found
because this supplier's products are not listed.
Ah-Lai Law, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were digested with Prescission protease (Amersham Pharmacia Biotech) and used to produce monoclonal antibodies as described42 and to raise polyclonal rabbit antiserum #4457 (Eurogentec). The NHSL1 monoclonal antibody was subcloned twice (clone C286F5E1 ...
-
No products found
because this supplier's products are not listed.
Ying Fu, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... VHHs were loaded at 10 µg/ml in kinetics buffer (PBS with 0.1% protease-free BSA and 0.02% Tween-20 in PBS) onto Ni-NTA biosensors (Molecular Devices, ForteBio). Biosensors were hydrated for 10 minutes in water ...
-
No products found
because this supplier's products are not listed.
Xiao Han, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 grams of yeast powder was dissolved in 30 mL binding buffer with 50 µL protease inhibitor cocktail IV (BioWorld), and 300 µL of 100 mM PMSF ...
-
No products found
because this supplier's products are not listed.
Julian A. Harris, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A single bicistronic baculovirus encoding the human Gβ1 subunit with a N-terminal 6x His-tag and rhinovirus 3C protease site and untagged human Gγ2 subunit was generated using the BestBac method (Expression systems) in Spodoptera frugiperda (Sf9 ...
-
No products found
because this supplier's products are not listed.
Christopher A. Rice, et al.,
bioRxiv - Microbiology 2020
Quote:
... Trophozoites were routinely grown axenically at 27°C in Protease Peptone-Glucose Media (PG) in non-vented 75 cm2 tissue culture flasks (Olympus), until the cells were 80-90% confluent ...
-
No products found
because this supplier's products are not listed.
Abdul Wahaab, et al.,
bioRxiv - Microbiology 2023
Quote:
PTrc His-A vector harboring various JEV NS2B-NS3 proteases were propagated in Escherichia coli DH5 (TIANGEN Biotech, Beijing, China) and extracted using Plasmid Miniprep Kit (Corning ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology, Inc., (Texas A&M) or R&D Systems (UCSD) ...
-
No products found
because this supplier's products are not listed.
Mu-Sen Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The His6-MBP-Cas9 fusion protein was cleaved to remove the His6-MBP tag by adding the TEV protease to the dialysis tubing (Spectrum labs) during dialysis against buffer containing 20 mM HEPES pH 7.5 ...
-
No products found
Agnieszka A. Gil, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 50 μL of 1 μM mCherry (with its His-tag cleaved off using TEV protease) was added onto 0.17 mm glass-bottomed black walled 96 well plate (In Vitro Scientific). 2 μL of the nanobody bead slurry was added to the well with mCherry solution and incubated for at least an hour and up to overnight ...
-
No products found
because this supplier's products are not listed.
Alexey A. Komissarov, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a DNA fragment containing the hepatitis A virus 3C protease (3Cpro) gene with EcoRI and KpnI sites was generated by PCR using the primers GACTGAATTCGCCACCATGTCAACTCTAGAAATAGCAGG and CAACGGTACCTTACTGACTTTCAATTTTCTTATCAATG (Evrogen, Russia), and pBI-EGFP-3C [11] as the template ...
-
No products found
because this supplier's products are not listed.
Michal Uflewski, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and protease inhibitor cocktail) and incubated with nucleotide-linked agarose beads (AMP and ATP affinity test kits, Jena Biosciences, Jena, Germany) overnight on the wheel at 4°C at a final concentration of 0.2% ß-DM ...
-
No products found
because this supplier's products are not listed.
Tim Kaminski, Vladimir P. Zhdanov, Fredrik Höök,
bioRxiv - Biophysics 2021
Quote:
... The supernatant was then supplemented with protease inhibitor and extruded through a 100-nm pore filter using an Avanti Mini Extruder (Avanti Polar Lipids), seven times ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 0.1% SDS) supplemented with protease inhibitors (MilliporeSigma, 11836170001) was added to each well after rinsing with PBS (Phosphate Buffered Saline; Lonza, 17-517Q). Cells were scraped into RIPA buffer on ice using 1 mL pipette tips ...
-
No products found
because this supplier's products are not listed.
Matthew E. Griffin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1x cOmplete EDTA-free protease inhibitor cocktail (MilliporeSigma) using 30-40 strokes with a 20-mL Potter-Elvehjem tissue grinder (Wheaton, Millville, NJ) followed by centrifugation at 15,000 g for 10 min at 4 °C ...
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
because this supplier's products are not listed.
Joanna R. Thomas, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 15 minutes of Protease III (ACD) at 40°C and 1:750 dilution of OPAL570 or OPAL690 reagents (Akoya Biosciences, Marlborough, MA). Immunohistochemistry for claudin-5 co-localization was performed after RNAScope staining ...
-
No products found
because this supplier's products are not listed.
Adan Pinto-Fernandez, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... phosphor and protease inhibitor cocktails (25 x 106cells per condition) and subjected to immunoprecipitation using 5 μg ISG15 antibodies (Boston Biochem #A-380) plus 25 μL of protein G Sepharose slurry (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2020
Quote:
... One μl of each protease inhibitor or anticoagulant dissolved in dimethyl sulfoxide (DMSO) was added to the 384-well plates (Greiner Bioscience, Frickenhausen, Germany). Next ...
-
No products found
because this supplier's products are not listed.
Meredith H. Wilson, et al.,
bioRxiv - Physiology 2019
Quote:
... cell lysate (35 μg) prepared in buffer K containing protease inhibitor cocktail was incubated with donor vesicles containing NBD-labeled triolein (Setareh Biotech, LLC, #6285) and acceptor vesicles ...
-
No products found
because this supplier's products are not listed.
Paola Munoz-Tello, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... using a pET-46 tobacco etch virus (TEV) protease-cleavable N-terminal hexahistidine tag fusion protein in M9 media supplemented with 15NH4Cl (Cambridge Isotope Labs, Inc.). Nurr1 LBD was eluted against a 500 mM imidazole gradient through a Ni-NTA column ...
-
No products found
because this supplier's products are not listed.
Gudrun Liebscher, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Snap- frozen samples of iBAT were homogenized in NP40-free lysis buffer (0.5 mM DTT in 50 mM Tris-HCl (pH 8.0) and freshly added protease and phosphatase inhibitors) using a tapered tissue grinder (DWK Life Sciences, Milville, New Jersey). The homogenate was passed through a 25G needle 6 times and centrifuged for 10 min at 1,000 x g and 4°C (pellet ...
-
No products found
because this supplier's products are not listed.
Hector Han-Li Huang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 150 mM NaCl and 1X HALT phosphatase/protease inhibitor cocktail (Pierce, 78442) for timecourse experiments or 8 M Guanadine-Cl (Gdn, Chem Impex Intl., 00152- 1KG), 0.1 M Tris pH 8.5 ...
-
No products found
because this supplier's products are not listed.
Shi-Bin Hu, et al.,
bioRxiv - Genetics 2023
Quote:
... 0.1% SDS) supplemented with 1x HALT protease inhibitor and 1x PhosSTOP phosphatase inhibitor (Thermo) with a mechanical homogenizer (IKA T10 basic S5 Ultra-turrax Disperser). Homogenized tissue samples were freeze-thawed and centrifuged at 13,000g for 20 minutes at 4°C and the supernatant retained for quantification and Western analysis ...
-
No products found
because this supplier's products are not listed.
Wei Zhong Zhu, et al.,
bioRxiv - Physiology 2022
Quote:
... frozen heart tissues were lysed with 1X Extraction Buffer with a protease inhibitor cocktail and the OGA inhibitors PUGNAc 20 µmol/L (Toronto Research Chemical, North York, ON, Canada) and Thiamet-G 1 µmol/L (Adooq Bioscience ...
-
Cat# ACM37259588,
Inquire
No citation found on bioRxiv
-
Catalog Number: B2014284 (1000 units)
SUMO Protease is a high quality SUMO Protease . This...
Cat# B2014284,
USD $995.0
No citation found on bioRxiv
-
Protease recombinant is a fusion protein of glutathione S-transferase (GST) and human rhinovirus...
Cat# abx073528-50IU,
50 IU USD $261.0
No citation found on bioRxiv
-
Cat# Ovs-060,
1 vial, USD $2,394
No citation found on bioRxiv
-
Peptide to HIV Protease SubstRate
Cat# CCP1266,
1 mg USD $120.0, 5 mg USD $360.0, 10 mg USD $600.0
No citation found on bioRxiv
-
Cysteine Protease inhibitor is a inhibitor of cysteine protease.
Cat# 921625-62-9,
Inquire
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Recombinant Mouse Antibody is closely related to binding with protease, expressed in Chinese...
Cat# MOB-809,
Inquiry
No citation found on bioRxiv
-
Protease-Free BSA is suitable for stabilising/enhancing diluent in enzyme systems,...
Cat# BSA-7100570-1kg,
1kg, Inquire
No citation found on bioRxiv
-
Cat# CPP-AAD-025,
inquiry, contact supplier for pricing
No citation found on bioRxiv