-
No products found
Nikolai Schleussner, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... KM-H2 or L428 cells were treated with 12 U/mL DNaseI (Worthington) for 3 mins at 22°C ...
-
No products found
because this supplier's products are not listed.
Alessandro Foti, et al.,
bioRxiv - Biochemistry 2023
Quote:
Chemical synthesis of HNP1 and halogenated analogs was performed by Biosynth International ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Tao Zhang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and then tubes were shaken for 45 minutes (Analog Vortex Mixer, Ohaus), after which they were spun down at 3300 rpm ...
-
No products found
because this supplier's products are not listed.
Milka Doktorova, et al.,
bioRxiv - Biophysics 2023
Quote:
... the fluorescent lipid analogs (Topfluor SM and Topfluor Chol, Avanti Polar Lipids) were first dissolved in DMSO at a final concentration of 1 mg/ml ...
-
No products found
because this supplier's products are not listed.
Monica Cappelletti, et al.,
bioRxiv - Immunology 2021
Quote:
... Lipids were extracted from the AF using methanol to measure prostaglandins PGE2 (Oxford Biomedical Research, Oxford, MI) and PGF2α (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Madalena Cipriano, et al.,
bioRxiv - Bioengineering 2021
Quote:
... that controls the analog amplification of voltage in the photon multiplier tube (PMT) and thus the sensitivity of the detector to the signal ...
-
No products found
because this supplier's products are not listed.
Jiali Yu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 500 μM indole-3-acetic acid (IAA, chemical analog of auxin, C3290, APExBIO) was used to induce CTCF degradation.
-
No products found
because this supplier's products are not listed.
ZN. Mihalic, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1-mM CaCL2 in H2 O) supplemented with 1:100 protease/phosphatase inhibitor cocktail (Cell Signaling). The protein content was measured using a Pierce BCA assay kit (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2022
Quote:
... cells were treated with 5μM ATP analog 3-BrB-PP1 (Toronto Research Chemicals; A602985) during 18 °C incubation for 1.5 hr to inactivate Sty1 kinase activity before being collected ...
-
No products found
because this supplier's products are not listed.
Lina Freage, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The monomer OSJ-T3-LNA was synthesized using locked analog phosphoramidite bases (Glen Research) to modify the first and the second bases (5’ end ...
-
No products found
because this supplier's products are not listed.
Mae M. Lewis, Travis J. Beck, Debadyuti Ghosh,
bioRxiv - Bioengineering 2023
Quote:
... as well as their analogs were selected from the ionizable lipid category from BroadPharm (https://broadpharm.com/product-categories/lipid/ionizable-lipid) ...
-
No products found
because this supplier's products are not listed.
Anjali Patwardhan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... marburgensis was cultured on H2/CO2 (80/20%) at 65 °C in a 14-liter fermenter (New Brunswick Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Firyal Ramzan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkyne-tagged fatty acid analogs (alkyne-myristate (13-tetradecylnoic acid; 13-TDYA; Click Chemistry Tools 1164) or alkyne-palmitate (15-hexadecynoic acid ...
-
No products found
because this supplier's products are not listed.
Aron Broom, et al.,
bioRxiv - Biophysics 2020
Quote:
... For samples that were co-crystallized with the transition state analog (TSA) 5-nitrobenzotriazole (AstaTech), a 100 mM stock solution of the TSA was prepared in dimethylsulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Chuan Chen, et al.,
bioRxiv - Immunology 2022
Quote:
... Grids were cleaned with H2/O2 gas mixture for 15 s in PELCO easiGlow glow discharge unit (Ted Pella) and 1.8 μl of protein suspension was applied to the surface of the grid ...
-
No products found
because this supplier's products are not listed.
Jorge Amich, et al.,
bioRxiv - Immunology 2019
Quote:
... mice were perfused using an ISMATEC Reglo Analog pump (IDEX Health & Science LLC, Oak Harbor, USA) 2 minutes with PBS and 8 minutes with paraformaldehyde (PFA ...
-
No products found
because this supplier's products are not listed.
Yusuke Ohno, et al.,
bioRxiv - Cell Biology 2023
Quote:
The mixture of 250 µL of 44 mM EE-analog (dissolved in CD3OD; Cambridge Isotope Laboratories) and 250 µL of 112 mM Cys (dissolved in D2O [Cambridge Isotope Laboratories] containing 112 mM triethylamine ...
-
No products found
because this supplier's products are not listed.
Elizabeth M. Black, et al.,
bioRxiv - Cell Biology 2024
Quote:
Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
No products found
because this supplier's products are not listed.
Cintia Horta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
No products found
because this supplier's products are not listed.
Natalia Kruglova, et al.,
bioRxiv - Microbiology 2021
Quote:
... addition of 8 amino acids from the HIV gp41 (H2) and mutation of the furin cleavage site PRRA⟶A (ΔA) were introduced by PCR with Pfu polymerase (Sibenzyme, Russia) and verified by sequencing ...
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Dinesh Gupta, et al.,
bioRxiv - Microbiology 2022
Quote:
... to a final concentration of 2 µg/mL and the purine analog 8ADP (CarboSynth, San Diego, CA, USA) to a final concentration of 20 µg/mL were added from sterile ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Alex Quintero-Yanes, Aurélie Mayard, Régis Hallez,
bioRxiv - Microbiology 2022
Quote:
... Temperature (30 °C) was maintained stable during microscopy analysis using the Tempcontrol 37-analog 1 channel equipment (HemoGenix®) coupled to the Axio Imager Z1 microscope ...
-
No products found
because this supplier's products are not listed.
Silvia Pittolo, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... and photostimulation of alloswitch and its analogs were performed using an inverted laser-scanning confocal microscope (TCS SP5, Leica Microsystems) equipped with a HCX PL APO 40×/1.25-0.75-NA oil objective for imaging cultured cells ...
-
No products found
because this supplier's products are not listed.
Jan Auerswald, et al.,
bioRxiv - Biophysics 2020
Quote:
... and doped with 0.005 mol% of the red fluorescent lipid analog ATTO 633 DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine labeled with ATTO 633) obtained from ATTO-TEC GmbH (Siegen ...
-
No products found
because this supplier's products are not listed.
Nikolai P. Melnikov, Andrey I. Lavrov,
bioRxiv - Cell Biology 2023
Quote:
DNA-synthesizing cells were revealed by confocal laser scanning microscopy (CLSM) by the incorporation of thymidine analog 5-ethynyl-2’-deoxyuridine (EdU; Lumiprobe, 10540) in sponges vitally stained with cytoplasmic dye CellTracker DeepRed Dye (CellTracker ...
-
No products found
because this supplier's products are not listed.
Anna V. Elleman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The vibration stimulus was delivered to the galvanometer in concert with uncaging light using analog outputs of a patch clamp amplifier and stimuli designed in SutterPatch software (dPatch, Sutter Instrument). The analog uncaging trigger was used to drive illumination through the microscope objective with a LED driver (Cyclops ...
-
Cat# HY-13961-50 mg,
50 mg, USD $600.0
Ask
Vishruth Girish, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A 72-hour drug assay was performed to assess cellular sensitivity to the nucleotide analogs RX-3117 (MedChemExpress; cat. no. HY-15228) and 3-deazauridine (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Parul Sahu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and then incubated with 50 nM concentrations of synthetic miRNA target analog in 96 well plates (Corning™ 96-Well clear bottom, black walls) for 40 min at 37 °C ...
-
No products found
because this supplier's products are not listed.
Adam S. Lowet, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer, MFLX32460-40 and MFLX32460-42), which were recombined at the odor manifold before being delivered to the animal’s nose ...
-
No citation found on bioRxiv
-
No citation found on bioRxiv
-
PTGDS Antibody is a Rabbit Polyclonal against PTGDS.
Cat# abx304999-200UG,
200 µg USD $710.5
No citation found on bioRxiv
-
Peptide to Dermorphin Analog
Cat# CCP1179,
5 mg USD $39.0, 10 mg USD $65.0, 25 mg USD $117.0
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# DIA-0230724,
Inquiry
No citation found on bioRxiv
-
MGCD-265 is a potent, multi-target and ATP-competitive inhibitor of c-Met and VEGFR1/2/3 with...
Cat# S1361, SKU# S1361-50mg,
50mg, $970.00
No citation found on bioRxiv
-
Catalog Number: B2013124 (10 ug)
Prorelaxin H2(RLN2) Antibody is a high quality prorelaxin...
Cat# B2013124,
USD $595.0
No citation found on bioRxiv
-
The H2-T23 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 2294101.0,
1.0 μg DNA, NM_010398 (Mouse), Inquire
No citation found on bioRxiv
-
Reduces prostaglandin D2 and prostaglandin H2 to prostaglandin F2; prostaglandin D2 is not an...
Cat# EXWM-0090,
100 ug, contact supplier for pricing
No citation found on bioRxiv
-
This antibody is a recombinant mouse monoclonal antibody which specifically reacts with...
Cat# MRO-579-MZ,
Inquiry
No citation found on bioRxiv
-
IDO1 inhibitor
Sold for research purposes only.
Cat# 2215.0, SKU# 2215-25 mg,
25mg, US $280.50 / EA, EURO, €255 / EA
No citation found on bioRxiv
-
Prostaglandin ( PGE2 ) Multi-Format ELISA / assay Kit
Cat# K051-H5,
1.0 ea, USD $1375.0
No citation found on bioRxiv