-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Benjamin J. Meckiff, et al.,
bioRxiv - Immunology 2020
Quote:
... plated in 6-well culture plates at a concentration of 5 × 106 cells/ml in 1 ml of serum-free TexMACS medium (Miltenyi Biotec) and left overnight (5 % CO2 ...
-
No products found
because this supplier's products are not listed.
Xiyin Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Mice were randomly divided into treatment groups: progesterone pellet (Innovative Research of America ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
Cat# HY-N0437-100 mg,
100 mg, USD $60.0
Ask
Giang Thi Tuyet Nguyen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The Human Endogenous Metabolite Compound Library was from MedChemExpress.
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Yunfeng Zhang, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
No products found
because this supplier's products are not listed.
Byron Lee, Nima Jaberi-Lashkari, Eliezer Calo,
bioRxiv - Cell Biology 2022
Quote:
HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Cortney R. Halsey, et al.,
bioRxiv - Microbiology 2021
Quote:
... Extracellular metabolites were determined using Roche Yellow Line Kits (R-Biopharm), according to the manufacturer’s recommendation ...
-
No products found
because this supplier's products are not listed.
Víctor Garrigós, et al.,
bioRxiv - Microbiology 2023
Quote:
... Other metabolites were measured with commercial kits (Megazyme Ltd, Bray, Ireland).
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
No products found
because this supplier's products are not listed.
Elle C. Roberson, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... while progesterone receptor cre (PR-Cre, Stock: 017915) 24 and smoothened floxed (Smofl/+, Stock: 004526) 25 animals were obtained from Jackson Labs. Mice were housed in individually ventilated cages in a pathogen-free facility with continuous food and water ...
-
No products found
because this supplier's products are not listed.
Sonja Blasche, et al.,
bioRxiv - Microbiology 2019
Quote:
Dried polar metabolites were derivatized with 50 μl of 20 mg/mL methoxyamine hydrochloride (Alfa Aesar, UK) solution in pyridine for 90 min at 37°C ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Clara Schmidt, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... are seeded in a 24-well plate (TPP, #92024) at 30-40k cells per well in E8 + ROCKi (5 µM Y-27632, Tocris #1254). All differentiation media are based on CDM that consists of 5 mg/ml bovine serum albumin (Europa Biosciences ...
-
No products found
because this supplier's products are not listed.
Randy Yoo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 96-well plate low volume crystallization plates (Hampton Research) were all set up at room temperature using sitting drop method with ratios 1:1 and 1:2 for precipitant to protein ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
Lars Kaiser, et al.,
bioRxiv - Cell Biology 2020
Quote:
Metabolite measurement was performed using a 4000 QTRAP mass spectrometer (ABI Sciex), connected to a NexteraXR HPLC (Shimadzu) ...
-
Progesterone is an endogenous steroid hormone involved in the menstrual cycle, pregnancy, and...
Cat# S1705, SKU# S1705-10mM/1mL,
10mM/1mL, $130.00
Ask
Satyaki Sengupta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
5 x105 SH-SY5Y cells were seeded into 10 cm plates and treated with either 5 µM EED226 (Selleck Chemicals) or DMSO (vehicle control ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Simon Matoori, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
The ammonia concentration of a 100 µM ammonia solution (17%, v/v) was determined in the presence of a mixture of drugs and metabolites (dopamine (TCI), levofloxacin (Sigma Aldrich Chemie) ...
-
No products found
because this supplier's products are not listed.
Isidoro Cobo, et al.,
bioRxiv - Cell Biology 2021
Quote:
The metabolites from sera and supernatant were obtained by ultrafiltration (32) using a 3KDa filter (3kDa Omega, Pall Corporation, #OD003C34) with a final standard concentration of 0.5 millimolar (mM ...
-
No products found
because this supplier's products are not listed.
Jirina Zackova Suchanova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
No products found
because this supplier's products are not listed.
Manmeet Bhalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bacterial titers were confirmed by plating on tryptic soy agar plates supplemented with 5% sheep blood agar (Hardy Diagnostics).
-
No products found
because this supplier's products are not listed.
Martijn Selten, et al.,
bioRxiv - Neuroscience 2023
Quote:
AAV8 viruses were produced in HEK293FT cells grown on 5 plates (linear PEI, Polysciences Europe Cat. No. 23966-100) or 10 plates (branched PEI ...
-
No products found
because this supplier's products are not listed.
Michael Ronzetti, et al.,
bioRxiv - Biochemistry 2022
Quote:
The DSF assay plate was constructed by dry-spotting 5 nL of SYPRO Orange with an acoustic dispenser (Echo 555, Labcyte) into a 384-well PCR plate ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Laura Mòdol, Monika Moissidis, Oscar Marín,
bioRxiv - Neuroscience 2023
Quote:
... a custom-made head plate containing a 5 mm diameter hole was fixed to the skull using veterinary adhesive (Vetbond, 3M). Once the head plate was fixed and stabilized ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cultures were incubated statically at 37°C with 5% CO2 followed by plating on TSA plates supplemented with 100 µl of catalase (38,000 U/ml; Worthington Biochemical Corporation, NJ) and the desired antibiotic (250 µg/ml kanamycin or 200 µg/ml streptomycin) ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 100 or 300 tachyzoites were plated in HFF monolayers grown in a 24-well plate and 4-6 days later were counted by microscopy (4x objective) (Nikon Eclipse Ti-5).
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The working plate (96-well plate) was used as a source plate for robotic spotting using a ROTOR HDA benchtop robot (Singer Instruments, United Kingdom) on rectangular OmniTray plates (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...
-
No products found
because this supplier's products are not listed.
Régis E Meyer, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 1-NMPP1 (5 μM, Calbiochem; 5 mM stock in dimethylsulfoxide) were added to the medium at the time of prophase exit ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
David M. Zong, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... An aluminium plate seal (Diversified Biotech) was applied and the plate was frozen at -20 °C.