-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Laurent Schmied, et al.,
bioRxiv - Immunology 2022
Quote:
... followed by blocking with peptide-based Fc blocker (Innovex Biosciences) for 30 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Elisa M Nabel, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with 2% isoflurane and head-fixed on in a mouse stereotactic apparatus (Narishige International USA Inc.) equipped with a heating pad ...
-
No products found
because this supplier's products are not listed.
Joseph W. Fowler, et al.,
bioRxiv - Cell Biology 2022
Quote:
Cells were washed in PBS and treated for 1hr with plain EBM-2 containing 2.5μg/mL DiI-LDL (Kalen Biomedical). Cells were washed for 5min with acid wash (25mM Glycine ...
-
No products found
because this supplier's products are not listed.
J. Ibáñez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... bipolar EMG from the TA was recorded with two surface Ag-AgCl electrodes 2 cm apart (WhiteSensor 40713, Ambu). The ground electrode was placed on the right ankle ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Christopher D. Pull, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
We measured the foraging success of individual bees on exiting and re-entering the colony using weight-averaging scales for moving subjects (mean of three repeat measurements with 2s averaging and accuracy of ± 2 mg; Advanced portable balance Scout STX123 120g; OHAUS Corporation) and their lifetime foraging activity and survival using an RFID system (MicroSensys GmBH ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were washed and cryopreserved in a 1:1 mixture of CS10 (BioLife Solutions) and Plasma-Lyte A (Hanna Pharmaceutical) supplemented with 2% HSA (Access Biologicals). Cryopreserved cells were thawed and activated with anti-CD3/anti-CD28 TransAct (Miltenyi ...
-
No products found
because this supplier's products are not listed.
Anne-Stéphanie Rueff, et al.,
bioRxiv - Microbiology 2023
Quote:
... bacteria were harvested at OD595nm of 0.1 and incubated with 1/1000 of Pneumococcus type 2 Rabbit antiserum (SSI Diagnostica, 16745) for 5 min on ice ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Andrew S. Bray, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the suspension serially diluted and plated onto LB agar plates (Fisher, BP9745-2) In between sampling the plates were sealed with parafilm (Bemis, PM-999) and placed in the dark at room temperature.
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jessica Trinh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... water was replaced with 500 μL of either water or water containing MAMP before pressure-infiltrating for 2 minutes at 30 mm Hg in a vacuum desiccator (SP Bel-Art #F42025-0000). Leaf disks were collected at 0 ...
-
No products found
because this supplier's products are not listed.
Jonathan Pansieri, et al.,
bioRxiv - Biophysics 2020
Quote:
... Aβ42 fibrils were prepared by incubating 100 μM Aβ42 peptide in phosphate buffer saline (PBS, Medicago) at pH 7.4 and 42°C ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
Recombinant monoclonal antibody to GLP-1R (Glucagon-like peptide receptor 1). This antibody...
Cat# TAB-146CT,
Inquiry
Ask
Haizhang Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... Recombinant CD20 was obtained as a peptide (aa141-188) containing the binding region of rituximab (Creative Biolabs). FcγR-specific mAbs were obtained from Stem Cell technologies (CD16 ...
-
No products found
because this supplier's products are not listed.
Maria Körner, et al.,
bioRxiv - Cell Biology 2023
Quote:
Pulldown assays using immobilized GST fusion proteins or biotinylated peptide (Biotin- CQGLYFHINQTLREAHFHSLQHRG-COOH; PANATecs GmbH, Tübingen, Germany) were essentially performed as described (Böhm et al ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Immunofluorescent staining of either differentiating cells in ALI wells or of the paraffin embedded human bronchus from healthy nonsmokers (Donor 1: Age 27, Female; Donor 2: Age 40, Female and Donor 3: Age 27, Female; catalog number HuFPT111, US Biomax, Inc., Rockville, MD, USA), or mouse trachea (C57BL/6 ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Sarath Vijayakumar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Protein kinases predicted to act on phosphorylation sites within the array peptide sequences were identified using GPS 3.0 and Kinexus Phosphonet (Kinexus Bioinformatics) (102–104) ...