-
No products found
because this supplier's products are not listed.
William J Mason, et al.,
bioRxiv - Physiology 2021
Quote:
... Helper plasmid delta F6 was purchased from Puresyn (Malvern, PA).
-
Rabbit polyclonal antibody to PI3K p110 delta
Cat# CPA1889,
200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0
Ask
Tiong Kit Tan, et al.,
bioRxiv - Immunology 2020
Quote:
... IgG-Alexa Fluor-647 mAb (Cohesion Biosciences, Generon,), IgA-FITC polyclonal Ab (BioRad Antibodies ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
Viruses utilized in this study were SARS-CoV-2 lineage B.1.617.2 (Delta Variant) culture fluid (heat inactivated, 0810624CFHI, Zeptometrix LLC, USA) and SARS-CoV-2 lineage B.1.1.529 (Omicron Variant ...
-
No products found
because this supplier's products are not listed.
Lindsey R. Conroy, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Recombinant PNGaseF Prime was obtained from Bulldog Bio, Inc ...
-
No products found
because this supplier's products are not listed.
Elena Terraza-Silvestre, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Primary antibodies were: anti-LC3 (1/200, 5F10, mouse mAb, NanoTools 0231-100) or anti-AU (1/1000 ...
-
No products found
because this supplier's products are not listed.
Fahad Paryani, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the percentage of positive FITC+/- that were PI+/- were quantified by FCS express 7 (De Novo Software). The experiment was replicated 4 times.
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Natasha Ting Lee, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant mouse t-PA (0.9 mg/kg; Molecular Innovations, MI, USA) or saline (equi-volume ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Marc Sunden, et al.,
bioRxiv - Biochemistry 2023
Quote:
A peptide (NH2-KKKYPGGSTPVSSANMM-COOH) containing an O-GlcNAcylation site of human Casein kinase II subunit alpha (underlined sequence) was custom synthesized by Nordic BioSite. A mixture of 6 mM glutaraldehyde ...
-
No products found
because this supplier's products are not listed.
Ning Zhou, et al.,
bioRxiv - Plant Biology 2024
Quote:
... The kinase reaction was quenched by adding SDS-PAGE loading buffer and then the NFR1, NFR1Y429F, and NFR1T481A kinase activities were analyzed using the anti-pTyr (GeneScript, CAT.A01819) or anti-pSer/Thr (ECM Biosciences, CAT.PP2551) antibodies ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Alejandro M. Gomez, et al.,
bioRxiv - Immunology 2023
Quote:
... was induced by retro-orbital injection of a cocktail of 5 monoclonal antibodies (mAbs) against mouse collagen type II (anti-CII cocktail, Chondrex Inc), followed by intraperitoneal injection of lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Manuel V. Borca, et al.,
bioRxiv - Microbiology 2019
Quote:
... Recombinant transfer vector p72mCheryΔI177L was obtained by DNA synthesis (Epoch Life Sciences Missouri City, TX, USA).
-
No products found
because this supplier's products are not listed.
Young Sun Hwang, M. Andrés Blanco, Kotaro Sasaki,
bioRxiv - Developmental Biology 2022
Quote:
... hiPSCs were cultured on plates coated with recombinant laminin-511 E8 (iMatrix-511 Silk, Nacalai USA) and maintained under feeder-free conditions in StemFit® Basic04 medium (Ajinomoto ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Fatima Amer-Sarsour, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-α-Fetoprotein (ScyTek A00058); rabbit anti-α-smooth muscle actin (Abcam 32575) ...
-
No products found
because this supplier's products are not listed.
Huilei Wang, et al.,
bioRxiv - Physiology 2023
Quote:
... COLIV rabbit polyclonal (Assay Biotech C0157), beta Actin Loading Control Monoclonal Antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Daniel Kirchmeier, et al.,
bioRxiv - Immunology 2023
Quote:
... rabbit α-CD3 (SP7, Diagnostic Biosystem), rabbit α–human CD103 (EPR4166(2) ...
-
No products found
because this supplier's products are not listed.
Georgi K. Marinov, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 µL of each synthetic sgRNA were incubated at room temperature with 1 µL of recombinant purified dCas9 (MCLab dCAS9B-200) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Haley E. Mudrick, et al.,
bioRxiv - Immunology 2021
Quote:
... and Rabbit Anti-Hamster IgA (Brookwood Biomedical). For mouse samples ...
-
No products found
because this supplier's products are not listed.
Stefanie Lübke, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... rabbit anti-β -Gal 1:5000 (Biotrend), rabbit anti-GFP 1:500 (abcam) ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Gonzalo Sanchez, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IFT88 (F41236 NSJ Bioreagents, host: rabbit, 1:200), SSTR3 (E-AB-1607 Elabscience ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
PI(3)P diC8 is a synthetic, purified dioctanoyl PI(3)P. PI(3)P is enriched in early endosomes...
Cat# 214068-76-5,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... Bacteria were stained with rabbit anti-capsule (Type 4 (Statens Serum Institut, 16747) and Type 23F serum (Statens Serum Institut ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...