-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Alexandra M. Amen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10-30% confluent U-251 cells were transduced at low MOI in 12-well plates with the lentivirus EF1a-BFP_Rsv-Bsd (5 µl; GenTarget, #LVP365) or EF1a-hTERT_Rsv-Bsd (50 µl ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Paola Moreno-Roman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5% NGS (Capralogics GS0250), washed 3 times in PBT ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
Native Antigen
Cat# AH01-100,
100µg USD $289.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Mohamad Ibrahim Cheikh, et al.,
bioRxiv - Biophysics 2022
Quote:
... plates were covered in light halocarbon oil (Halocarbon Oil 27, Sigma). Embryos with a distinctive faint halo in the periphery ...
-
No products found
because this supplier's products are not listed.
Jayne T. Wolfe, et al.,
bioRxiv - Bioengineering 2023
Quote:
... A rectangular parallel plate flow chamber (#31-010, GlycoTech, Gaithersburg, MD) was placed on top of the cultured cells using vacuum pressure to form a seal ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Apsra Nasir, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5% Fetal Bovine Serum (FBS) (Peak Serum, PS-FB2), ITS (Lonza ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... The plates were revealed using TMB One as the substrate (Kementec, 4380A). All dilutions and washing were performed in barbital/tween buffer (4 mM sodium barbital ...
-
No products found
because this supplier's products are not listed.
Melpomeni Platani, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Screened compounds were selected from the appropriate chemical library plates containing Cloud library (Enamine) and an in-house library of publicly available compounds ...
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Abrar Choudhury, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... whole skulls were subsequently embedded in 5% low-melt agarose (Precisionary) and cut into 300µm sections on a Vibratome (VT1000S ...
-
No products found
because this supplier's products are not listed.
Thibault Scalvenzi, et al.,
bioRxiv - Genomics 2021
Quote:
... 20 and 5 μm filters (nylon 40 μm cell strainer from BIOLOGIX; 20 μm net ring from Pharmacia Fine chemicals ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Joseph C. Reynolds, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Membranes were blocked for 1 hour using 5% BSA (Akron Biotech, USA, #AK8905-0100) in tris-buffered saline containing 0.05% Tween-20 (Bio-Rad #161-0781 ...
-
No products found
because this supplier's products are not listed.
Kota Kaneko, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PLC/PRF/5 cells were treated with HGF and SHP099 (10 μM; CHEMIETEK; CT-SHP099) or trametinib (10 nM ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Aaron A. Vogan, et al.,
bioRxiv - Genetics 2019
Quote:
... we inoculated HPM plates with either a polycarbonate Track Etched 76 mm 0.1 μm membrane disk (Poretics, GVS Life Sciences, USA)(Psk1xS5 and Psk7xS5 ...
-
No products found
because this supplier's products are not listed.
M. A. Rossotti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... three-fold dilutions of VHH-Fcs were prepared in V- Bottom 96-well microtiter plates (Globe Scientific, Mahwah, NJ, Cat# 120130) and mixed with 50 µL of CHO-SPK cells ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
... The plates for the islets were placed on a mat heated at 37 °C on a H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Alexander A. Choi, Limin Xiang, Wan Li, Ke Xu,
bioRxiv - Biophysics 2023
Quote:
... the coverslips were functionalized with 10 mg/mL methoxy PEG silane (5 kDa, M-SLN-5000, JenKem Technology) in 95% ethanol/water for 30 min ...
-
No products found
because this supplier's products are not listed.
Adebayo O. Shittu, Tomiwa Adesoji, Edet E. Udo,
bioRxiv - Microbiology 2020
Quote:
... aureus genotyping Kit 2.0 (Alere Technology, Jena, Germany) as described previously [10] ...
-
No products found
because this supplier's products are not listed.
Kathleen E. DelGiorno, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... slides were stained using a kit (IHC world) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Yodai Takei, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The custom-made automated sampler was used to move designated readout probes in hybridization buffer from a 2.0 mL 96-well plate through a multichannel fluidic valve (IDEX Health & Science EZ1213-820-4) to the custom-made flow cell using a syringe pump (Hamilton Company 63133-01) ...
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Shruti D Shah, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... samples were embedded in paraffin and sectioned at 5 microns on Starfrost adhesive slides (Mercedes Medical; Catalog #MER 7255/90/WH). Slides were deparaffinized in three xylene baths and then rehydrated in graded 100% to 70% alcohols ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Masahide Sakabe, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Neonatal rat cardiomyocyte culture was performed using the neonatal cardiomyocyte isolation kit (Cellutron). P2 neonatal cardiomyocytes were plated on tissue culture dishes pre-coated with SureCoat (Cellutron ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Clotilde Laussel, et al.,
bioRxiv - Genetics 2022
Quote:
... The assay was performed using the 2DG uptake measurement kit (Cosmo Bio USA, Carlsbad ...
-
No products found
because this supplier's products are not listed.
Misato Okamoto Miyakawa, Hitoshi Miyakawa,
bioRxiv - Evolutionary Biology 2022
Quote:
... Samples were prepared using a CyStain UV Precise P Kit (Sysmex Partec., GmbH.). Each body ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...