-
No products found
because this supplier's products are not listed.
Argentinian AntiCovid Consortium, et al.,
bioRxiv - Biochemistry 2021
Quote:
... including an N-terminal TEV site followed by a Gly-Gly-Gly sequence and a Gly-Ser-GLy-Ser-GLy spacer (Met-Glu-Asn-Leu-Tyr-Phe-Gln-Gly-Gly-Gly-Gly-Ser-GLy-Ser-Gly-BLS) was assembled and cloned in the pET11a vector (Novagen). The construct was checked by sequencing ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
... amine-functionalized magnetic beads (Dynabeads™ M-270 Amine, Invitrogen) were washed and resuspended in PBS prior to coupling ...
-
No products found
because this supplier's products are not listed.
Wenyue Cao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... a fluorogenic MPro substrate DABCYL-Lys-Thr-Ser-Ala-Val-Leu-Gln-Ser-Gly-Phe-Arg-Lys-Met-Glu-EDANS from Bachem, and K777 as a gift from Prof ...
-
No products found
because this supplier's products are not listed.
Tigist Y. Tamir, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... including flexible Gly-Ser-Ser-Gly linkers between NL and BRSK2 (Promega). For cellular BRSK2 NanoBRET target engagement experiments ...
-
No products found
because this supplier's products are not listed.
Li Wan, et al.,
bioRxiv - Immunology 2024
Quote:
... Ly-6G/Ly-6C (108404, BioLegend) at 1:1000 ...
-
No products found
because this supplier's products are not listed.
Argentinian AntiCovid Consortium, et al.,
bioRxiv - Biochemistry 2021
Quote:
The tetramethylrhodamine (TMR) labeled peptide with sequence Gly-Gly-GLy-Ser-{Lys-(TMR)}was purchased from Genscript. Its mass ...
-
No products found
because this supplier's products are not listed.
Claire C. Weckerly, et al.,
bioRxiv - Cell Biology 2024
Quote:
Palmitoyl oleoyl (PO) phospholipids (Avanti Polar Lipids) dissolved in chloroform:methanol solution were dried under nitrogen gas and resuspended in Buffer A comprised of 150 mM NaCl and 20 mM Tris pH 7.5 to generate a 2 mM solubilized lipid mixture ...
-
No products found
because this supplier's products are not listed.
Laure Maneix, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Ly-6G and Ly-6C (clone RB6-8C5, BD Biosciences), anti-CD8α (clone 53- 6.7 ...
-
No products found
because this supplier's products are not listed.
Luca Franchini, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 1-oleoyl lysophosphatidic acid (Tocris), DAMGO (MedChemExpress) ...
-
No products found
because this supplier's products are not listed.
Alexander Kapustin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Peptides were Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP, Merck, SCP0157) and scramble control Gly-Arg-Ala-Asp-Ser-Pro (GRADSP ...
-
No products found
because this supplier's products are not listed.
Luis F. Schachner, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lys-C (Roche), Glu-C (Roche) ...
-
No products found
because this supplier's products are not listed.
Brent Townshend, et al.,
bioRxiv - Bioengineering 2020
Quote:
... using the amine coupling kit (GE Healthcare) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jan Knoblauch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
No products found
because this supplier's products are not listed.
Julia T. Tanzo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Final reaction conditions were 100 µM substrate (N-oleoyl-leucine, Cayman Chemical 20064, N-oleoyl-phenylalanine, Cayman Chemical 28921 ...
-
No products found
because this supplier's products are not listed.
Madanraj Appiya Santharam, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... medium (M: R6K4 = +10Da) isotopes (13C on Arg, 4 D on Lys; Cambridge isotope laboratories ...
-
No products found
because this supplier's products are not listed.
Bhagyashree Dasari Rao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and primary secondary amine (PSA, Agilent Technologies) (dispersive solid phase) ...
-
No products found
because this supplier's products are not listed.
Antonio Cibelli, et al.,
bioRxiv - Neuroscience 2020
Quote:
... LY was iontophoresed (continuous current of 0.1 μA) for 5 min using an electrometer (model 3100; A-M Systems) into single cells using sharp microelectrodes filled with the dye (LY ...
-
No products found
because this supplier's products are not listed.
Ratnadeep Mukherjee, et al.,
bioRxiv - Immunology 2020
Quote:
... amine coupling kit were procured from Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Sila Ozdemir, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Random Amine chemistry with Amine Coupling Second Generation kit (Sartorius) was used to load K-Ras G12D ligands on Amine Reactive Second Generation (AR2G ...
-
No products found
because this supplier's products are not listed.
Jeremy M. Shea, Saul A. Villeda,
bioRxiv - Neuroscience 2024
Quote:
... supplemented with M-CSF (10ng/m) (Peprotech, 315-02) and antibiotic mix ...
-
No products found
because this supplier's products are not listed.
Elena Lo Furno, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... PcnamUb Lys 164 (13439, Cell Signaling Technology); PCNA (PC10 ...
-
No products found
because this supplier's products are not listed.
Paromita Mitra, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Lys-27 trimethylated histone H3 (ab6002) and Lys-27 acetylated histone H3 (ab177178) (all purchased from Abcam, MA, USA). Normal IgG was used as negative control ...
-
No products found
because this supplier's products are not listed.
Anouk Lepez, et al.,
bioRxiv - Immunology 2020
Quote:
... anti-CD8α (Ly-2)- and anti-CD90.2-MicroBeads (Miltenyi Biotec, Bergisch-Gladbach, Germany) and then separated over an auto-MACS column using the DepleteS program.
-
No products found
because this supplier's products are not listed.
Aidan C. Daly, et al.,
bioRxiv - Systems Biology 2024
Quote:
... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
No products found
because this supplier's products are not listed.
Lisa Käshammer, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 15 mg Fmoc-D-Lys(Biotin)-OH (Santa Cruz Biotechnology) was stirred in 3.1 mL of 20% piperidine/dimethylformamide and 466 μL toluene for 40 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Bonita H. Powell, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... RPL26 1:1000 dilution (Bethyl A300-686A-M Lot#A300-686A-M-1), Actin 1:10,000 dilution (Sigma A1978-100μL Lot#065M4837V) ...
-
No products found
because this supplier's products are not listed.
Robin Green, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... Yeast strains with ura3 deletion in lys- and lys-met17- background were generated via crosses and transformed with GFP-Atg8 plasmid (Addgene 49425) to generate the two strains used in the autophagy assays—WY2520 (lys- ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... Subsequent addition of 300 µM Z-Gly-Arg thiobenzyl (MP Biomedicals) and 100 µM 5,5′-dithiobis(2-nitrobenzoic acid ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... an imidazoquinoline amine analog to guanosine (Invivogen). TLR9 or TLR7 activation was normalized to SEAP levels produced by infected null1 parental cells and is expressed as the fold-change over mock infected controls ...
-
No products found
because this supplier's products are not listed.
Marco Y. Hein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Samples were digested overnight by adding lys-C (VWR, 100369-826) at an enzyme-to-protein ratio of 1 mAU per 50 µg ...
-
No products found
because this supplier's products are not listed.
Samantha Y. Liu, et al.,
bioRxiv - Immunology 2024
Quote:
... recombinant human lymphotoxin α1/ β2 (rhLTα1/β2) (R&D Systems, Cat# 8884-LY) or recombinant human IFNγ (PeproTech Cat# 300-02 ...
-
No products found
because this supplier's products are not listed.
Giulio Di Minin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Sections were incubated in TNB blocking solution (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.5% Blocking reagent PerkinElmer_FP1012) at room temperature for 30’ ...
-
No products found
because this supplier's products are not listed.
Stephen Adonai Leon-Icaza, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 0.1 M Sodium Cacodylate (EMS). Samples were embedding in Durcupan ACM resin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Sangsin Lee, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Infinite M Plex microplate reader (Tecan) was used to inject 50 μl of the assay buffer containing CTZ and measure the photon emission integrated over 30 s ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (4-(1,2,4,5-tetrzain-3-yl)phenyl)methanamine (tetrazine amine) was purchased from Kerafast (FCC659, lot: 2014). 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine ...
-
No products found
because this supplier's products are not listed.
Philip Lauman, Jonathan J. Dennis,
bioRxiv - Microbiology 2022
Quote:
In-vitro f(lys) experiments were performed using flat bottom 24-well plates (Corning, USA), with the same bacterial inoculum ...
-
No products found
because this supplier's products are not listed.
Samantha Pierson, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rodent Block M (Biocare) was added for 20 minutes before 2 × 5-minute 1X Dako buffer washes ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 40 kDa amine-reactive PEG (succinimidyl succinimide ester, SAS) (Creative PEGWorks, Durham, NC) was reacted with trans-cyclooctene (TCO)-amine or Tetrazine (Tz)-amine (Vector Laboratories, Newark, CA) in dichloromethane (DCM) ...
-
No products found
because this supplier's products are not listed.
Jesslyn E. Park, et al.,
bioRxiv - Molecular Biology 2023
Quote:
tRNA-Tyr and tRNA-Val probes were labeled with IRDye800RD and the tRNA-Gly probe was labeled with IRDye680RD (LI-COR), respectively ...
-
No products found
because this supplier's products are not listed.
Iana Gadjalova, et al.,
bioRxiv - Immunology 2022
Quote:
... M-CSF (Immunotools) for 7 days ...
-
No products found
because this supplier's products are not listed.
Martin Ng, et al.,
bioRxiv - Immunology 2024
Quote:
... RNA was isolated from the sorted Ly-6Chi monocytes using the RNeasy Mini Kit (QIAGEN), quantified using the Quant-iT RiboGreen RNA Assay Kit ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Immunology 2022
Quote:
... DM6000-M microscope (Leica Microsystems) was used to acquire images.
-
No products found
because this supplier's products are not listed.
Nicole Kiweler, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Gas chromatograph was equipped with a 30 m (I.D. 250 μm, film 0.25 μm) ZB-35MS capillary column with 5 m guard column (Phenomenex). Helium was used as carrier gas with a constant flow rate of 1.2 ml/min ...
-
No products found
because this supplier's products are not listed.
Yu Fujimura, et al.,
bioRxiv - Cell Biology 2020
Quote:
... FITC (fluorescein isothiocyanate)-conjugated anti-Ly-6G (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Andre S Godoy, et al.,
bioRxiv - Biophysics 2024
Quote:
... comprising 0.12 M NPS Mix (consisting of 0.3 M Sodium phosphate dibasic dihydrate, 0.3 M Ammonium sulphate, and 0.3 M Sodium nitrate from Molecular Dimensions), along with 0.1 M MES/Imidazole at pH 6.5 (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Liliana S. O. Silva, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 25 % PEG 4K and 0.2 M MgCl2 plus the additive NaCl (2 M) (Hampton Research). Crystals of YtfEM-E159L were prepared by the hanging drop vapour diffusion method using 1:1 μL mixtures of protein-reservoir solution ...
-
No products found
because this supplier's products are not listed.
Yun-Ling He, et al.,
bioRxiv - Cell Biology 2020
Quote:
... M-MLV reverse transcriptase and RNase inhibitor (TaKaRa, D2639A). Q-PCR was performed in triplicate with Power SYBR® Green (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Josiah B. Passmore, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The Cell^M/xcellence software module (Olympus) was used to quantify the relative fluorescence intensities of roGFP2 at 400 and 480 nm excitation ...
-
No products found
because this supplier's products are not listed.
Adam M. Tuttle, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and an AxioCam 506 m CCD camera (Carl Zeiss). This setup allowed acquisition of images with X-Y dimensions of 662 µm × 492 µm ...
-
No products found
because this supplier's products are not listed.
Kuan-Jung Chen, Jia-Wei Hsu, Fang-Jen S. Lee,
bioRxiv - Cell Biology 2021
Quote:
... connected to an imaging system (Nikon, DS-5 M). The invaded cells in at least three fields per well were counted using ImageJ software.