-
No products found
because this supplier's products are not listed.
Marito Hayashi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti-NTS (Immunostar 20072, 1:2000), Rabbit anti-SST (Novus 906552 MAB2358 ...
-
No products found
because this supplier's products are not listed.
Larysa Poluben, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-AR (NT) (RevMab Biosciences, #31-1135-00, 1:2000), anti-ARv7 (RevMAb Biosciences ...
-
No products found
because this supplier's products are not listed.
Jin Wang, et al.,
bioRxiv - Systems Biology 2019
Quote:
... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
No products found
because this supplier's products are not listed.
Brooke A. Hall, et al.,
bioRxiv - Microbiology 2024
Quote:
... 10 μg of total protein for both NT and Rab siRNA-transfected samples were resolved in 4-20% gradient SDS-PAGE (Mini-PROTEAN Gel ...
-
No products found
because this supplier's products are not listed.
Surbhi Verma, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human MDMs (hMDMs) were isolated from human PBMCs and separated from healthy human donors’ blood using PolymorphPrep (PROGEN,1895) layering and centrifugation ...
-
No products found
because this supplier's products are not listed.
Jing Guo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... RNA molecules ranging from 50 to 100 nt were selected to construct a small RNA library using the NEXTFLEX Small RNA-Seq Kit (Bioo Scientific) and then subjected to Illumina HiSeq sequencing (paired-end ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Alexa Schuettenberg, et al.,
bioRxiv - Immunology 2022
Quote:
... normal human IgG (ProSci #5503) on each plate as a positive control ...
-
No products found
because this supplier's products are not listed.
Michael A. Hardigan, et al.,
bioRxiv - Genomics 2019
Quote:
... DNA was sheared using the Covaris E220 and size selected for an average insert size of 300-nt using magnetic beads (Mag-Bind® RxnPure Plus, Omega Bio-tek). Libraries were pooled and sequenced on the Novaseq at UCSF for average 8x genome coverage in the diversity panel ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Thi K. Tran-Nguyen,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant human GRP78s purchased from StressMarq Biosciences or produced in the laboratory [30] were used as antigens in ELISA ...
-
No products found
because this supplier's products are not listed.
Neuza S. Sousa, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Recombinant human MANF (P-101–100; Icosagen) was used as a standard ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Yuichi Mitsui, et al.,
bioRxiv - Immunology 2022
Quote:
Human PBMCs were purchased from Precision for Medicine, Inc ...
-
No products found
because this supplier's products are not listed.
Xindi Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-human IBA1 (Aves Labs, IBA1-0020), mouse anti-human TMEM119 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Molly Ohainle, et al.,
bioRxiv - Microbiology 2019
Quote:
... supplemented with 5% heat-inactivated human AB+ serum (Omega Scientific), 20 mM GlutaMAX-I ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The full cDNA sequence of the lncRNA was then amplified with forward primer: 5’- GTATCATAAGGATCCCTTTCCACTGCTCTGGTGAG-3’ and reverse primer: 5’- GTATCATAAGTCGACCTCACCTAGCTGTCTGTCC-3’ and cloned into pAAV-MCS (Cat#: VPK-410, Cell Biolabs Inc.) using the restriction enzymes BamH I and HindIII sites ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A goat anti-human AAT polyclonal antibody 80A was purchase from ICL Inc ...
-
No products found
because this supplier's products are not listed.
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
GFP-expressing human embryonic kidney cells (i.e., GFP-HEK cells, GenTarget Inc.) were used as an RNP delivery cell model ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... Human commensal type strains were grown on either Brain Heart Infusion (Teknova) agar plates supplemented with 5 μg/mL hemin and 0.5 μg/mL menadione (BHIS ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 µl of secondary antibody (goat anti-human IgG Fc; Meridian Life Science) at a 1:4,000 dilution in blocking buffer was applied to each well for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...