-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Chiara Galante, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Red Fluorescent Protein (RFP, rabbit, 1:500, Biomol, 600401379S); SRY-Box 10 (Sox10 ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Li Dai, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1% w/v 800 nm Protein G-coated polystyrene beads (Spherotech Inc) were washed in the same way as the streptavidin beads ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
Emily G. Armbruster, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and protein expression was induced by IPTG (isopropyl ß-D-1-thiogalactopyranoside, Teknova) as indicated ...
-
No products found
because this supplier's products are not listed.
Priya Crosby, et al.,
bioRxiv - Biochemistry 2023
Quote:
Mouse CRY1 PHR domain (residues 1-491) was expressed in Sf9 suspension insect cells (Expression Systems) as previously described (Parico et al. ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Cellular protein was extracted by treating 1e7 cells / mL in ice-cold 1 x RIPA buffer (Boston BioProducts), containing protease inhibitors (Roche ...
-
No products found
because this supplier's products are not listed.
Yongxing Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... some mice were anesthetized and mouse lungs were harvested and homogenized using a Mini-Beadbeater-1 (Biospec, Bartlesville, OK). The lung homogenates were used to count lung colony-forming units (CFUs) ...
-
No products found
because this supplier's products are not listed.
Francois Chesnais, et al.,
bioRxiv - Bioengineering 2022
Quote:
... a co-culture of 7.5×103 Red Fluorescent Protein-tagged HUVEC (RFP-HUVEC, 2Bscientific, UK) and 1×105 Normal Human Dermal Fibroblasts (NHDF, Promocell) or Human Mesenchymal Stem cells (MSC ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Minghui Di, et al.,
bioRxiv - Molecular Biology 2023
Quote:
HeLa cells were transfected with DNA (1 ug) expressing mCherry-tagged proteins cultured on 29-mm glass-bottom dish (Cellvis); plasmids (1 ug ...
-
No products found
because this supplier's products are not listed.
Yibo Tang, et al.,
bioRxiv - Immunology 2023
Quote:
The conjugations of peptides to the KLH protein carrier were performed according to the manufacturer instructions of ReadiLink™ KLH Conjugation Kit (AAT Bioquest, Cat.#5502). In brief ...
-
No products found
because this supplier's products are not listed.
Isabell Bludau, et al.,
bioRxiv - Systems Biology 2022
Quote:
The molecular weight calibration curve for SEC fractionation was obtained by running a protein standard mix (Column Performance Check Standard, Aqueous SEC 1, AL0-3042, Phenomenex, CA, USA) before each sample injection (Supplementary Table 19).
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Yi Xiang See, Kaijing Chen, Melissa J. Fullwood,
bioRxiv - Genomics 2021
Quote:
... Cells were fixed in 1% formaldehyde and sonicated using the truChIP Chromatin Shearing Kit (Covaris) on the ME220 Focused-Ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... and protein eluted with CoWB containing 400 mM Imidazole (RPI). The eluate was concentrated with a 10,000 MWCO centrifugal filter (Millipore-Sigma ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
Recombinant Mouse TYRP1 Protein with a His tag was expressed in HEK293.
Cat# TYRP1-17676M,
20ug , USD $298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Isadora Matias, et al.,
bioRxiv - Neuroscience 2021
Quote:
Protein concentration in cell extracts was measured by the BCA Protein Assay Kit (Cole-Parmer). Forty micrograms protein/lane was electrophoretically separated on a 10% SDS polyacrylamide gel and electrically transferred onto a Hybond-P PVDF transfer membrane (Millipore ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yuancheng Lu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Mouse anti-Klf4 (1:1000, ReproCell, 09-0021), Rabbit anti-p-S6 (S240/244 ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 0.05% Triton X-100 in 1X PBS pH 7.2 supplemented with mouse-on-mouse blocking reagent (Vector Biolabs; 1:50) and Fc receptor blocker reagent (Innovex Biosciences ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Katherine J. Turner, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rabbit anti-green fluorescent protein (GFP; Torrey Pines Biolabs, Cat# TP401, dilution 1:1000), rat anti-GFP (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
El Batoul Djouani-Tahri, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Total cellular proteins were labeled by adding 5 μCi mL-1 of [35S] Na2SO4 (American Radiolabeled Chemicals) for 10 min ...
-
No products found
because this supplier's products are not listed.
Sebastian Pöhl, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was then purified using zinc-affinity chromatography using a 1 mL Zn-NTA column (Cube Biotech) equilibrated with lysis buffer containing 5 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Dorit Möhrle, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... 2) KD (weight ratio of fat to carbohydrate plus protein is approximately 6.3:1, F3666, Bio-serv, NJ). Percentage calories provided by each nutrient category are ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... prepared as a 1:1 mixture of DMEM/F12 (PAN Biotech) and Neuropan basal medium (PAN Biotech ...