-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Sanna Hellberg, et al.,
bioRxiv - Physiology 2020
Quote:
... and Phospholipids C kit (Fujifilm, Wako Diagnostics), respectively.
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and incubated overnight with rocking at 4°C with anti-human apoA-I primary antibody (mouse monoclonal, 1:8000, Meridian Life Sciences). Membranes were washed 3X for 10min with 1X TBS-T (0.1% Tween 20 ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
Cat# F101,
USD $80.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Wakana Sato, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... at 37°C for 1 hour and agarose gel-purified with GenCatch Advanced Gel Extraction Kit (Epoch Life Science, Inc., No. 2260050). eGFP fluorescence was measured at λex 488 nm and λem 509 nm with plate reader PMT setting “medium” and 6 reads per well ...
-
No products found
because this supplier's products are not listed.
Bo Fan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... post-baked (65 °C and 95 °C for 1 min and 4 min, respectively) and developed in SU-8 developer (MicroChem). The SU-8 was hard-baked at 180 °C for 1 hour after development ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... and 1 µg of mouse E2 (UBE2E3, Boston Biochem) in 40 µl of reaction buffer (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... by dialysis at 4 °C (1000 g mol-1 MWCO; Spectrum Laboratories), 4 times 6 h ...
-
No products found
because this supplier's products are not listed.
Fana B. Mersha, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... overnight at 37°C using a filter aided sample preparation kit (Expedeon, San Diego CA). For a complete protocol see [36] ...
-
No products found
because this supplier's products are not listed.
Cory A. Diemler, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PLX5622 was acquired from Chemgood (C-1521) and formulated in Purina 5K52 mouse chow diet at a concentration of 1200mg/kg (ppm) by Research Diets Inc ...
-
No products found
because this supplier's products are not listed.
E Hsu, NR Zemke, AJ Berk,
bioRxiv - Molecular Biology 2020
Quote:
... were grown at 37°C in a BronchiaLife medium complete kit (LL-0023; Lifeline Cell Technology) in a 5% CO2 incubator until they reached confluence ...
-
No products found
because this supplier's products are not listed.
Naidi Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the body temperature of the mouse was maintained at 37 °C using a homeothermic monitoring system (No. 69020, RWD life science).
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 0.05% Triton X-100 in 1X PBS pH 7.2 supplemented with mouse-on-mouse blocking reagent (Vector Biolabs; 1:50) and Fc receptor blocker reagent (Innovex Biosciences ...
-
No products found
because this supplier's products are not listed.
Yongchan Lee, et al.,
bioRxiv - Biochemistry 2019
Quote:
... UniProt ID Q01650) and CD98hc isoform c (SLC3A2 isoform 1; UniProt ID P08195-1) were amplified from human universal reference cDNA (ZYAGEN) and cloned individually into the pEG BacMam vector (84) ...
-
No products found
because this supplier's products are not listed.
Giulia Mori, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... Sitting-drop vapor diffusion crystallization experiments were set up at 18 °C using a 1:1 protein:reservoir ratio dispensed with the Mosquito liquid handler (TTP Labtech). Single crystals of the GgUox-AZA complex were obtained after two-three days in the alternative orthorhombic space groups C2221 or P212121 using 8% PGA-LM ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
HyStem-C version 2.0 provides the same cellular environment and workflow, while generating more...
Cat# GS313F,
7.5 mL, USD $290.0
Ask
Jinlun Bai, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... individual ROs were live-embedded in 100 µl 1% HyStem-C™ hydrogel (Advanced Biomatrix, #GS312) on Millicell™ 12 mm cell culture insert with 0.4 µm hydrophilic PTFE membrane (Sigma ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Eri Morimoto, Kotaro Tsuboyama, Yukihide Tomari,
bioRxiv - Biochemistry 2022
Quote:
... Anti-mouse antibody was used as the secondary antibody at 1:100 (Protein Simple).
-
No products found
because this supplier's products are not listed.
Vivian Salgueiro, et al.,
bioRxiv - Microbiology 2023
Quote:
... samples were hydrolyzed overnight in 6N HCl at 100°C in 1 ml capacity-crystal ampoules (Wheaton). Samples were dried and resuspended in water and mixed in a 1:1:1 ratio with pure acetic acid and ninhydrin reagent (250 mg ninhydrin ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mélisande Richard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cornea was removed and retinas were stained overnight at 4°C with Phalloidin-iFluor 488 (Biomol, 1/1000) in PBT BSA 0,1% ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Andrea Papait, et al.,
bioRxiv - Immunology 2023
Quote:
... Then the cells were plated and expanded until passage 1 (hAMSC p1) at a density of 1 x104 /cm2 in Chang medium C (Irvine Scientific, Santa Ana, CA, USA) supplemented with 2 mM L-glutamine at 37 °C in the incubator at 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Priya Crosby, et al.,
bioRxiv - Biochemistry 2023
Quote:
Mouse CRY1 PHR domain (residues 1-491) was expressed in Sf9 suspension insect cells (Expression Systems) as previously described (Parico et al. ...
-
No products found
because this supplier's products are not listed.
Rima Gnaim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 110 isolated bacteria colonies were transferred to 2 mL liquid marine broth (3.7 g·L-1) and kept for overnight at 32°C in a shaker incubator (180 RPM, Incu-Shaker Mini, Benchmark Scientific). The bacteria were stored in glycerol (final concentration of 25% ...
-
No products found
because this supplier's products are not listed.
Jiachen Sun, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1 mM phenylmethylsulphonyl fluoride (PMSF) (PH 7.9) and lysed using a hand-held homogenizer (Tissue Grinder Size C; Thomas Scientific). After centrifugation of the homogenate ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Liangliang Hao, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The reduced C-terminal cysteine (1 eq.) was reacted with sulfo DBCO-maleimide crosslinker (4 eq.) (Click Chemistry Tools, AZ, USA) in PBS (pH 6.5 ...
-
No products found
because this supplier's products are not listed.
Rogan A. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... Remaining cells were then pelleted at 400g for 5 minutes at 4°C and resuspended at 1×106 cells/mL in ice-cold BamBanker medium (Bulldog Bio BB02). Cell suspensions were aliquoted at 2.5-5.0×105 cells and frozen directly at −80°C until sorting.
-
No products found
because this supplier's products are not listed.
Stefan E. Spirig, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and the pHGT1-Adeno1 helper plasmid carrying adenoviral genes (kindly provided by C. Cepko, Harvard Medical School, Boston, USA) using PEIMAX (Polyscience, #POL24765-1). Plasmids were mixed in 98 mL DMEM (Thermo Fischer ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Kenneth Johnson, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C in flow chambers (IBI scientific, UK). The system was sterilized by pumping a 0.2 % of hypochlorite solution for 1 hour using a peristaltic pump ...
-
No products found
because this supplier's products are not listed.
Shiran Barber-Zucker, et al.,
bioRxiv - Biophysics 2020
Quote:
... Protein was then labelled overnight at 4 °C with (1-oxyl-2,2,5,5-tetramethylpyrrolidin-3- yl)methylthiosulfonate spin label (MTSL, 20x excess) (Toronto Research Chemicals Inc., North York, Ontario, Canada) with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Rosa Machado, et al.,
bioRxiv - Biophysics 2019
Quote:
... we warmed the objective to 37 °C using an objective heater (Bioptechs). In some experiments we used a custom-made microscope incubation chamber ...
-
No products found
because this supplier's products are not listed.
Eriko Ohgitani, et al.,
bioRxiv - Microbiology 2021
Quote:
... and RNA was extracted using TRI Reagent(C) LS (Molecular Research Center, Inc. ...
-
No products found
because this supplier's products are not listed.
Katelyn A. Bustin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (Bullet Blender, BBY24M model, Next Advance, Inc., speed 8, 3 min, 4 °C), samples were diluted in PBS (500 μL ...
-
No products found
because this supplier's products are not listed.
Domokos I. Lauko, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated overnight at 28°C in Grace’s with 10% FBS (Gemini Bio-Products). Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio ...
-
No products found
because this supplier's products are not listed.
Voddu Suresh, et al.,
bioRxiv - Microbiology 2021
Quote:
... Digestion was carried out at 37°C for 16 hours using trypsin (Sciex, #4326682) at a final concentration of 1:20 (w/w) ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and Buffer C is the buffer recommended by the CleanCap® AG manufacturer (Trilink) for use with WT T7RNAP ...
-
No products found
because this supplier's products are not listed.
Evelyn Ploetz, et al.,
bioRxiv - Biophysics 2020
Quote:
... The radio-labelled compounds [3 H]-asparagine and [14 C]-glutamine were obtained from American Radiolabeled Chemicals and PerkinEllmer ...