-
No products found
because this supplier's products are not listed.
Qing Tang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and the cleaved actin and thymosin β4-His6 moiety were separated by ion-exchange chromatography with SuperQ-5PW resin (Tosoh Bioscience, Japan) using a 0-0.5 M NaCl gradient in G-Buffer ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... B.1.351 (Beta; Cube Biotech # 28721), P.1 (Gamma ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Alejandro Tamayo, et al.,
bioRxiv - Physiology 2021
Quote:
... We immunostained beta cells (insulin; Accurate Chemical & Scientific, Wesbury, NY), alpha cells (glucagon ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG, Teknova), unless otherwise specified.
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Ching-Chieh Chou, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and anti-Beta tubulin III (Tuj1) (1:500; Neuromics, CH23005 & 1:1000; Biolegend, 801201). The tNeurons were washed with PBS three times and incubated with fluorophore-conjugated secondary antibody solution in the dark for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Marah H. Wahbeh, et al.,
bioRxiv - Genetics 2023
Quote:
... and 1:100 BME (Beta-mercaptoethanol; Thermo #21985023) with freshly added SMAD Inhibitors SB431542 (Reprocell #NC1388573) at 20uM and LDN193189 (Peprotech #1062443 -1mg ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were fixed with 4% PFA at 4 days post-infection and processed with Immunohistochemistry (IHC) using mouse monoclonal anti-VZV antibody (Meridian Life Sciences C05108MA, 1:2000 diluted in PBS), followed by incubation with biotinylated anti-mouse IgG (Vector Laboratories #BA-9200) ...
-
No products found
because this supplier's products are not listed.
Seong-Beom Park, et al.,
bioRxiv - Neuroscience 2021
Quote:
... dehydrated using an ethanol series (50%, 4 min; 75%, 4 min; 95%, 4 min; 100%, 4 × 4 min) and cleared with Histoclear II (National Diagnostics, Atlanta, GA, USA) (3 × 4 min) ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Jialiang S. Wang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... under the control of the chicken beta actin (CAG) promoter (AAV8-CAG-mOstn-WPRE and AAV8-CAG-eGFP vectors) were generated (Vector Biolabs). 3-week-old mice were injected with AAV8 by intraperitoneal (IP ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
C Spourquet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Virginia Hargest, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads for 4 minutes on speed setting 4 (Next Advance air cooling bullet blender), and pelleted by centrifugation at 12,000 rpm for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Carena Cornelssen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... using 4% paraformaldehyde (Thomas Scientific) in 1x phosphate buffer saline (Dulbecco’s) ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Kawsar Hossain, et al.,
bioRxiv - Neuroscience 2024
Quote:
... incubated with EdU reaction solution (4 mM CuSO4, 4 µM Sulfo-Cyanine 3 Azide [Lumiprobe] ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 4 μM human UbcH5α/UBE2D1 (Boston Biochem), 3 μM uAb (or equivalent control protein) ...
-
No products found
because this supplier's products are not listed.
Qin Luo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... standard fluorescence detector (4 photomultiplier tubes (PMT) and 6 filter cubes) ...
-
No products found
because this supplier's products are not listed.
Anqi Zhang, et al.,
bioRxiv - Bioengineering 2023
Quote:
4-0 silk sutures (Fine Science Tools) were used to ligate the ECA and temporarily stop blood flow in CCA and posterior auricular artery (PAA) ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Yi-Nan Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant mouse Flt3 ligand (Flt3L) and mouse SCF were purchased from Shenandoah Biotech (Warwick, PA). Cells were stained with appropriate concentrations of mAbs ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Alain Valdivia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and gemcitabine from ApexBio (A8437|CAS: 95058-81-4) were reconstituted in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Qian Xue, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-mCherry (Encor Biotechnology, MCA-1C51), rabbit anti-pY118 Paxillin (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... The purified viruses were quantified by solid-phase indirect ELISA (Supplementary methods) and tested in an Octet RED bio-layer interferometer (Pall ForteBio, California, CA, USA) for receptor binding against sialoglycopolymers - α2,3-α1-4(6-HSO3)GlcNAc (3SLN(6-su)) ...
-
No products found
because this supplier's products are not listed.
Jamie C Kwasnieski, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 mM disulfide biotin azide (Click Chemistry Tools, Scottsdale, AZ) was added to a 10 μL reaction containing RNA ...
-
No products found
because this supplier's products are not listed.
Fabio Henrique Brasil da Costa, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Tissue samples were decalcified using Formical-4™(StatLab, TX, USA), fixed with formalin and paraffin-embedded (FFPE) ...
-
No products found
because this supplier's products are not listed.
Eleni Kafkia, et al.,
bioRxiv - Systems Biology 2020
Quote:
... mouse anti-lamin B1 (1:500, Atlas Antibodies, AMAb91251) and anti-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Giulia Ferrari, et al.,
bioRxiv - Cell Biology 2021
Quote:
... FACS data analysis was done using FCS Express 4 (De Novo Software). A similar procedure was followed for FACS cell purification ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... Custom mouse diets were formulated at Research Diets (New Brunswick, NJ ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...