-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Yuancheng Lu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Mouse anti-Klf4 (1:1000, ReproCell, 09-0021), Rabbit anti-p-S6 (S240/244 ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... and 1 µg of mouse E2 (UBE2E3, Boston Biochem) in 40 µl of reaction buffer (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Briana N Markham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-GAPDH (Meridian Life Sciences, H86504M, 1:750,000), mouse IgG2b anti-PINK1 (Novus ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 0.05% Triton X-100 in 1X PBS pH 7.2 supplemented with mouse-on-mouse blocking reagent (Vector Biolabs; 1:50) and Fc receptor blocker reagent (Innovex Biosciences ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Charneal L. Dixon, et al.,
bioRxiv - Immunology 2023
Quote:
... cDNA was synthesized from 1 µg RNA using SensiFAST cDNA Synthesis Kit (FroggaBio; Concord, Canada). qPCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System in conjunction with a SybrGreen System (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... Custom mouse diets were formulated at Research Diets (New Brunswick, NJ ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μM 1-NM-PP1 (Toronto Research Chemicals; A603003) was added into one of the cultures to inactivate Cdc2 (Cdk1 ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Yongrong Qiu, et al.,
bioRxiv - Neuroscience 2022
Quote:
We recorded light stimulus-evoked Ca2+ signals in GCL cells of the explanted mouse retina using a MOM-type twophoton (2P) microscope (74, 75) from Sutter Instruments (purchased from Science Products ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 µg/mouse of IL-15 (Shenandoah Biotech) was injected three times per week with an intraperitoneal injection (ip) ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
Collected mouse tissue was fixed in 4% paraformaldehyde (4% PFA, Boston BioProducts) and stored in 70% ethanol until processed further ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Sandra Grund-Gröschke, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Mouse dorsal skin was homogenized with the Ultra-Turrax® (IKA, Staufen, Germany) in PBS supplemented with protease inhibitor (Sigma ...