-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Alessandra Mozzi, et al.,
bioRxiv - Microbiology 2022
Quote:
Autophagy was induced by amino acid and serum starvation in Earle’s Balanced Salt Solution (EBSS, ECB4055L, Euroclone) for the indicated times.
-
No products found
because this supplier's products are not listed.
Dianrong Li, et al.,
bioRxiv - Cell Biology 2021
Quote:
Antibodies for mouse RIPK3 (#2283; WB, 1:1000; IHC, 1:100) were obtained from ProSci. There other antibodies used in this study were anti-RIPK3(LS-C336804 ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Lisa Leib, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Starvation of cells was induced by washing the cells four times with Hanks’ Balanced Salt solution (HBSS; PAN Biotech; #P04-32505) for the indicated time points ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Yongxing Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... some mice were anesthetized and mouse lungs were harvested and homogenized using a Mini-Beadbeater-1 (Biospec, Bartlesville, OK). The lung homogenates were used to count lung colony-forming units (CFUs) ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Christian Stocker, et al.,
bioRxiv - Biochemistry 2023
Quote:
... *JbCDTCM crystals were obtained at 20 °C from a 1:1 (200 nL:200 nL) mixture of protein sample and solution C1 from the Morpheus crystallization screening kit (Molecular Dimensions Ltd.), containing 30% w/v PEG500MME_P20K (10% w/v PEG 20000 ...
-
No products found
because this supplier's products are not listed.
Willy Roque, et al.,
bioRxiv - Cell Biology 2020
Quote:
SA-β-gal staining was performed using the β-galactosidase kit (Dojindo Molecular Technology, 1824699-57-1) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Robert R. Bowers, et al.,
bioRxiv - Genetics 2021
Quote:
... coli kit (MS-CRED-KIT) was purchased from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Marta Gawrys-Kopczynska, et al.,
bioRxiv - Physiology 2020
Quote:
The effect of hydrodynamic and thermal stress on Atto 488 (ATTO-TEC GmbH) labeled LDH structure was evaluated by means of FCS ...
-
No products found
because this supplier's products are not listed.
Jiaxin Gong, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Shear stress stimulations were delivered horizontally through a glass micropipette (OD, 1.2 mm; ID, 0.69 mm; Sutter Instrument) at 1 mm away from the center of the imaging field ...
-
No products found
because this supplier's products are not listed.
Alison D. Parisian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human induced pluripotent stem cell (iPSC) line iPS12 was purchased from Cell Applications. This cell line is integration-free and was validated for pluripotency ...
-
No products found
because this supplier's products are not listed.
Seung-Yon Lee, et al.,
bioRxiv - Physiology 2024
Quote:
... was induced to differentiate using AdipoLife DfKt-2 Adipogenesis media (LifeLine Cell Technology), with medium changed every two days ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 µg/mouse of IL-15 (Shenandoah Biotech) was injected three times per week with an intraperitoneal injection (ip) ...
-
No products found
because this supplier's products are not listed.
Silvia Acosta-Gutiérrez, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Psomes were formed after this solution being under continuous shear stress using magnetic stirring (200 rpm, RT15 power, IKA-Werke GmbH & Co.) for 16 weeks ...
-
No products found
because this supplier's products are not listed.
Colbie R. Chinowsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Induced W4 cells were then incubated with either 20 µM Blebbistatin (B592500; Toronto Research Chemicals), 4 nM Calyculin A (PHZ1044 ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... and 1 µg of mouse E2 (UBE2E3, Boston Biochem) in 40 µl of reaction buffer (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Kameron L. Inguito, et al.,
bioRxiv - Cell Biology 2022
Quote:
Tendon stress deprivation was performed by placing isolated tendon fascicles in culture vessels submerged in serum-free DMEM (GenClone, Genesee Scientific, San Diego, CA, USA) consisting of 1% antimycotic/antibiotic (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Bavat Bornstein, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cre-mediated recombination was induced at the indicated time points by administration of 125 mg/kg of tamoxifen by oral gavage (Fine Science Tools).
-
No products found
because this supplier's products are not listed.
Ashley Velez-Delgado, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Expression of Kras* was induced in adult mice (8-14 weeks old) by replacing regular chow with Doxycycline chow (Bio-Serv, 1gm/kg). Acute pancreatitis was induced by administering eight hourly doses of caerulein (75μg/kg ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... The purified viruses were quantified by solid-phase indirect ELISA (Supplementary methods) and tested in an Octet RED bio-layer interferometer (Pall ForteBio, California, CA, USA) for receptor binding against sialoglycopolymers - α2,3-α1-4(6-HSO3)GlcNAc (3SLN(6-su)) ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Dinh-Vinh Do, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...