-
No products found
because this supplier's products are not listed.
Maria Körner, et al.,
bioRxiv - Cell Biology 2023
Quote:
Pulldown assays using immobilized GST fusion proteins or biotinylated peptide (Biotin- CQGLYFHINQTLREAHFHSLQHRG-COOH; PANATecs GmbH, Tübingen, Germany) were essentially performed as described (Böhm et al ...
-
No products found
because this supplier's products are not listed.
Kimberley El, et al.,
bioRxiv - Cell Biology 2023
Quote:
... levels were normalized to total protein levels (Sigma-Aldrich, #E3138, 1:1000 with Nacalai USA Signal Enhancer HIKARI), and total (i.e ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Qianying Zuo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
IN SITE Metastasis Kit (Xylyx Bio, Inc., NY) containing TissueSpec Bone (MTSBN101) ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Haugh, et al.,
bioRxiv - Microbiology 2020
Quote:
... or permeabilized with PBS containing 0.2% Triton X-100 (for stains of intracellular proteins) and treated with Fc receptor blocker (Innovex Biosciences), Richmond ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Joseph W. Fowler, et al.,
bioRxiv - Cell Biology 2022
Quote:
Cells were washed in PBS and treated for 1hr with plain EBM-2 containing 2.5μg/mL DiI-LDL (Kalen Biomedical). Cells were washed for 5min with acid wash (25mM Glycine ...
-
No products found
because this supplier's products are not listed.
J. Ibáñez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... bipolar EMG from the TA was recorded with two surface Ag-AgCl electrodes 2 cm apart (WhiteSensor 40713, Ambu). The ground electrode was placed on the right ankle ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Anne-Stéphanie Rueff, et al.,
bioRxiv - Microbiology 2023
Quote:
... bacteria were harvested at OD595nm of 0.1 and incubated with 1/1000 of Pneumococcus type 2 Rabbit antiserum (SSI Diagnostica, 16745) for 5 min on ice ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were washed and cryopreserved in a 1:1 mixture of CS10 (BioLife Solutions) and Plasma-Lyte A (Hanna Pharmaceutical) supplemented with 2% HSA (Access Biologicals). Cryopreserved cells were thawed and activated with anti-CD3/anti-CD28 TransAct (Miltenyi ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Anne Tersteegen, et al.,
bioRxiv - Immunology 2021
Quote:
Total DNA was isolated from tissues using a DNA isolation kit (Genekam) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nora Hartig, Kathrin M. Seibt, Tony Heitkam,
bioRxiv - Plant Biology 2022
Quote:
... PCR products were purified (As One International,Invisorb Spin DNA Extraction Kit) and ligation into pGEM-T plasmids (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Erica L. Stone, et al.,
bioRxiv - Immunology 2021
Quote:
... blocks were cut in 5 μm sections that were placed on glass slides for anti-IgG (UltraPolymer Goat anti-Mouse heavy and light chain IgG-HRP, Cell IDx, San Diego, CA, USA) or anti-C3 (EPR19394 ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Bapi Biswas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... donovani amastigotes in whole lysate was checked by Lipase Assay Kit (REAlGENE, US, Cat # 250069) expressed in Unit/μg ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... HA concentration was confirmed in the extracted samples with a Hyaluronic Acid test kit (Corgenix Specialists in ELISA & IVD Diagnostic Technology ...
-
No products found
because this supplier's products are not listed.
Nathan W. Zammit, et al.,
bioRxiv - Immunology 2019
Quote:
... Cells were lysed and adenoviruses were extracted using Aenopure kit according to instructions provided (PureSyn Inc.). The purified virus was titrated and quantified in HEK293 cells using the Adeno-X Rapid Titer Kit (clontech ...
-
No products found
because this supplier's products are not listed.
Veronica Ferrucci, et al.,
bioRxiv - Genetics 2020
Quote:
... Real-time RT-PCR was performed using ‘RealQquality RQ-2019-nCoV’ kits (Ab Analitica; IVD approved) for detection of the RdRp and E genes (from the SarsCov2 N gene) ...
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
The following protocol was adapted from the μMACS Streptavidin Kit protocol (Miltenyi): 1μg of biotinylated antibodies to CD26 or CD36 (Ancell) were added to 1ml of virus ...
-
No products found
because this supplier's products are not listed.
Rosalia Emma, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the bacterial suspensions were immediately used for AMES screening by following manufacturer’s protocol (Salmonella Mutagenicity Test Kit, MOLTOX®). Briefly ...
-
No products found
because this supplier's products are not listed.
Arundhasa Chandrabalan, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... All joint fluids were tested for presence of any blood with the Fecal Occult Blood Test kit (Immunostics Hema-Screen) and the samples showing presence of blood were excluded from further analysis.
-
No products found
because this supplier's products are not listed.
Christopher A. Hempel, et al.,
bioRxiv - Genomics 2022
Quote:
DNA and total RNA were separately extracted from samples in 96-well plates using the NucleoMag DNA/RNA Water kit (D-MARK Biosciences, Toronto, Canada) that includes magnetic beads ...
-
No citation found on bioRxiv
-
Catalog Number: B2013912 (1 set)
Serine/Threonine Kinase Inhibitor Set is a high quality...
Cat# B2013912,
USD $1095.0
No citation found on bioRxiv
-
No citation found on bioRxiv
-
D-threonine is an optically active form of threonine having D-configuration. It has a role as a...
Cat# PAP-0003,
, Inquire for price
No citation found on bioRxiv
-
PIM2 Fragment MS Protein Standard, is a protein fragment containing a 50-150 amino acid sequence...
Cat# CPILF37941,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
The PIM2 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 3669701.0,
1.0 μg DNA, BC018111; 1.0 μg DNA, BC027376; 1.0 μg DNA, NM_001172103, Inquire
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Cat# A2500-100RXN,
USD $159.36/ea
No citation found on bioRxiv
-
Colorless Silver Antimicrobial Solution, 2-10nm
Cat# ANT-0022,
25 kg, USD $4700.0
No citation found on bioRxiv