-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Dina Aweida, Shenhav Cohen,
bioRxiv - Cell Biology 2022
Quote:
... anti-phospho-Threonine/Serine from ECM Biosciences, and anti-PLAA from Invitrogen ...
-
No products found
because this supplier's products are not listed.
Margarita Anisimova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... supplemented with D-serine (30 μM, Tocris Bioscience; 0226) and diluted slightly to give ∼308 mOsm k-1 (33°C ...
-
No products found
because this supplier's products are not listed.
Maria Carmen Ocaña, et al.,
bioRxiv - Biochemistry 2021
Quote:
... serine and glycine free media were from Teknova (Hollister, CA, USA) and from US Biological Life Sciences (Salem ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Jeong Yeon Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Asserchrome D-dimer ELISA (#100947) from Stago (Asnières sur Seine, France) and Mouse total fibrinogen (#IMSFFBGKTT) from Innovative Research (Novi, MI) was used to analyse the samples in duplicates.
-
No products found
because this supplier's products are not listed.
Longlong Si, et al.,
bioRxiv - Microbiology 2020
Quote:
... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
No products found
because this supplier's products are not listed.
Stuart Sullivan, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and polyclonal antibodies raised against phosphorylated S744 of NPH3 using peptide KPRRWRNpSIS (where pS represents phosphorylated serine) as antigen (Eurogentec). Blots were developed with horseradish peroxidase (HRP)-linked secondary antibodies (Promega ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Aurelie de Rus Jacquet, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The number of CD63+ EVs collected in the EV-enriched fractions were estimated by ELISA (System Biosciences). The ELISA standards provided in the kit are calibrated by NTA to measure the number of exosomes and establish a standard curve based on exosome abundance ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Cristiana Bersaglieri, et al.,
bioRxiv - Genomics 2020
Quote:
... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
No products found
because this supplier's products are not listed.
Georgina Gyarmati, et al.,
bioRxiv - Physiology 2021
Quote:
... histological analysis of periodic acid-Schiff stain was performed on mouse kidney sections using PAS Stain Kit (24200-1, Polysciences, Warrington, PA). Images were visualized at 25× magnification using Leica TCS SP8 (Leica Microsystems ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Goat-anti-mouse IgG (Advansta) (1/10000 ...
-
No products found
because this supplier's products are not listed.
Jean-François Rivest, et al.,
bioRxiv - Genetics 2023
Quote:
... or from 30 mg of mouse liver using a EZ-10 Spin Column Animal Genomic DNA Miniprep Kit (Bio Basic, Markham, ON, CA), per the manufacturers’ recommendations ...
-
No products found
because this supplier's products are not listed.
Yuxuan Lin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mouse anti-Aub antibody (1:20) (Patil and Kai 2010) or mouse anti-mKate2 (Evrogen, 1:200) was added to the cleared lysate and incubated at 4°C for 2 h with rotation ...
-
No products found
because this supplier's products are not listed.
Ramhari Kumbhar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-PAR (4335-MC-100; Trevigen), rabbit anti-pan PAR (MABE1016 ...
-
No products found
because this supplier's products are not listed.
Jeffrey L Hansen, Barak A Cohen,
bioRxiv - Genomics 2021
Quote:
... or goat anti-mouse (Epicypher #13-0048) polyclonal secondary antibodies ...
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Sirisha Thippabhotla, Cuncong Zhong, Mei He,
bioRxiv - Bioengineering 2019
Quote:
The RNA library was prepared by using the commercial library preparation kit NEXTflex small RNA sequencing kit (Bioo Scientific, NOVA-5132-05) following the recommended protocol by the manufactures ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Lola Holcomb, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse serum samples were diluted 10-fold using the kit-specific reagent (SPCKA-MP-007374, Protein Simple, Bio-Techne), and the concentrations were measured following the manufacturer’s instructions on the Ella system ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Pati Moloko Maindo, et al.,
bioRxiv - Microbiology 2019
Quote:
Serum samples were routinely screened for HBsAg using ELISA (Hepanostika® HBs, Biomérieux, France and Abbott GmbH & Co. KG, Wiesbaden, Germany), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...