-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Yoko Miura, et al.,
bioRxiv - Pathology 2021
Quote:
... Histofine Simple Stain Mouse MAX-PO secondary antibodies were used and visualized using the Histofine SAB-PO (M) kit (Nichirei Biosciences). For immunofluorescence ...
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Inês Caldeira Brás, et al.,
bioRxiv - Neuroscience 2021
Quote:
... USP19 (1:1000, A301-587A-M, Biomol). On the next day ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Alessio Cardini, et al.,
bioRxiv - Plant Biology 2020
Quote:
Suggested model for the roles of putative genes encoding proteins involved in Zinc (Zn) transport-related processes in alfalfa (Medicago sativa). The sites of action in the plant (i.e. ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
A small GTPase of the Ras superfamily. Regulates stress fiber formation in response to growth...
Cat# RHOA-1145H,
25ug : USD $319
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Christopher M. Yellman,
bioRxiv - Genetics 2021
Quote:
... The native Nop1 protein was stained with the MCA-28F2 mouse monoclonal antibody (EnCor Biotechnology), followed by anti-mouse CY3 (Jackson ImmunoResearch)
-
No products found
because this supplier's products are not listed.
Sineadh M. Conway, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 0.1 M and N-hydroxysulfosuccinimide (NHSS; Bioworld) solutions for 1 hr to create a semistable reactive amine NHS ester ...
-
No products found
because this supplier's products are not listed.
Richard Drexler, et al.,
bioRxiv - Neuroscience 2023
Quote:
... chicken anti-neurofilament (M+H; 1:1000; Aves Labs) or PSD95 (1:500 ...
-
No products found
because this supplier's products are not listed.
Enrica Saponara, et al.,
bioRxiv - Physiology 2021
Quote:
... L-Type Triglycerol M (Wako Diagnostics, Enzyme Color R1 & R2), 96-well ...
-
No products found
because this supplier's products are not listed.
Tobias Nöbauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and meloxicam-containing (0.125 mg/tablet) food supplements (Bio-Serv #MD275-M). After surgery ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Erin E. Henninger, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×30 seconds at 6 M/s and zirconium/silica beads (BioSpec Products 11079105z). Next ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and anti-mouse (for HA; Covalab) were used as secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Kaarjel K. Narayanasamy, et al.,
bioRxiv - Biophysics 2021
Quote:
... Sections were picked up with a custom made metal loop in a droplet of 1% methylcellulose and 1.15 M sucrose and transferred to 35 mm glass bottom dishes (MatTek) pre-coated with 30 µg/ml of fibronectin from human plasma (Sigma ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Kevin W. Bollinger, et al.,
bioRxiv - Microbiology 2024
Quote:
... and Ldt3 was raised against purified protein (ProSci). To analyze protein levels by Western immunoblotting ...
-
No products found
because this supplier's products are not listed.
Dapeng Chen, Wayne A Bryden, Michael McLoughlin,
bioRxiv - Biochemistry 2020
Quote:
... The 10 μ m pore-size filter discs and the column sets were acquired commercially (figure 1, Boca Scientific, Dedham, MA). C18 resin beads with 20 μ m diameters were purchased from Hamilton (figure 1 ...
-
No products found
because this supplier's products are not listed.
Tomas C. Pascoa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... prior to denaturing intact protein mass spectrometry analysis the protein (2 mg mL-1) was incubated with 200 µM sphinganine (Avanti Polar Lipids), 200 µM fumonisin B1 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Eleni Kafkia, et al.,
bioRxiv - Systems Biology 2020
Quote:
... mouse anti-lamin B1 (1:500, Atlas Antibodies, AMAb91251) and anti-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...