-
No products found
because this supplier's products are not listed.
Natacha Mariano, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the three mini-procollagen samples (alone, with BMP-1, with BMP-1 + PCPE-1) were mixed and concentrated using the SP3 (single-pot ...
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Shan Jiang, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The protein standard with the C-terminal FLAG tag (E-PKSH032870.10) was from Biomol. Linear DNA templates were produced by PCR and were PCR purified ...
-
No products found
because this supplier's products are not listed.
Joanna Young, et al.,
bioRxiv - Microbiology 2020
Quote:
... phosphopeptides corresponding to the C-terminal of SFP1 were conjugated to Keyhole limpet hemocyanin and used to immunise 4 mice (Covalab). Day 53 sera showed reactivity against SFP1 ...
-
No products found
because this supplier's products are not listed.
Karishma Patel, et al.,
bioRxiv - Biochemistry 2019
Quote:
Peptides were synthesised as C-terminal amides using standard fluorenylmethyloxycarbonyl (Fmoc)-strategy solid-phase chemistry using a Syro I automated synthesiser (Biotage) and NovaPEG Rink Amide resin (Novabiochem) ...
-
No products found
because this supplier's products are not listed.
Joshua A. F. Sutton, et al.,
bioRxiv - Microbiology 2023
Quote:
A C-terminal fusion of GpsB with mCherry was designed in pOB (Horsburgh et al., 2002) and synthesised by GENEWIZ UK Ltd ...
-
No products found
because this supplier's products are not listed.
Liangliang Hao, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The reduced C-terminal cysteine (1 eq.) was reacted with sulfo DBCO-maleimide crosslinker (4 eq.) (Click Chemistry Tools, AZ, USA) in PBS (pH 6.5 ...
-
No products found
because this supplier's products are not listed.
Sanna Hellberg, et al.,
bioRxiv - Physiology 2020
Quote:
... and Phospholipids C kit (Fujifilm, Wako Diagnostics), respectively.
-
No products found
because this supplier's products are not listed.
Sylvia A Newbold, et al.,
bioRxiv - Neuroscience 2023
Quote:
... anti PCDH19 N-terminal (1:1000, orb312580, rabbit polyclonal, Biorbyt); anti-N-Cadherin (1:1000 ...
-
No products found
because this supplier's products are not listed.
Paulino Tallón de Lara, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Cells were also tested negative for 18 additional mouse pathogens by PCR (IMPACT II Test, IDEXX Bioanalytics).
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... II (SignaGen Laboratories). In all cases ...
-
No products found
because this supplier's products are not listed.
Fana B. Mersha, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... overnight at 37°C using a filter aided sample preparation kit (Expedeon, San Diego CA). For a complete protocol see [36] ...
-
No products found
because this supplier's products are not listed.
Jasmin Wächter, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and incubated with combinations of the indicated antibodies overnight at 4 °C: mouse monoclonal anti-HLA-G (clone 4H84; 1:100; Exbio); rabbit monoclonal anti-cytokeratin 7 (clone SP52 ...
-
No products found
because this supplier's products are not listed.
Cory A. Diemler, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PLX5622 was acquired from Chemgood (C-1521) and formulated in Purina 5K52 mouse chow diet at a concentration of 1200mg/kg (ppm) by Research Diets Inc ...
-
No products found
because this supplier's products are not listed.
Arielle M. Bryan, et al.,
bioRxiv - Microbiology 2021
Quote:
... neoformans H99 cells were opsonized for 1 hour at 37°C + 5% CO2 with shaking using 100 μl of complement-based media (20% mouse CD1 complement serum (Innovative Research) in serum-free medium) ...
-
No products found
because this supplier's products are not listed.
George R. Heaton, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... added to the Bio-safe II (RPI) scintillation cocktail and binding quantified using scintillation counting for H3 on an Tri-Carb 2810TR scintillation counter (Perkin Elmer).
-
No products found
because this supplier's products are not listed.
Isabella M. Gaeta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated with 1° antibodies for 1hr at 37°C (mouse anti-EPS8, BD Transduction Laboratories Cat#610144 1:400; Chicken IgY anti-GFP, Cat#GFP-1020 Aves Labs 1:200). Cells were then rinsed 4x for 5 minutes with PBS and incubated with 2° antibodies (Goat anti-mouse Alexa Fluor 488 F(ab’)2 fragment ...
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
LC Laboratories' Product Number S-7979 - SP600125 (Anthra(1,9-cd)pyrazol-6(2H)-one,...
Cat# S-7979, SKU# S-7979_2g,
2 g, $495.00
Ask
Jorida Coku, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... ceritinib (C-2086, LC Laboratories), and lorlatinib (5640 ...
-
No products found
because this supplier's products are not listed.
Tomás Bazzano, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and a transmission electron microscope (TEM JEOL-100 CX II). To obtain the SEM images ...
-
No products found
because this supplier's products are not listed.
Yuqi Gui, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in a wet chamber (Mini-PROTEAN II cell (BIO-RAD)) filled with transfer buffer (25mM Tris base ...
-
No products found
because this supplier's products are not listed.
Lola Holcomb, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse serum samples were diluted 10-fold using the kit-specific reagent (SPCKA-MP-007374, Protein Simple, Bio-Techne), and the concentrations were measured following the manufacturer’s instructions on the Ella system ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Natalia Gebara, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 2% Chang Medium C (Irvine Scientific), 20% Fetal Calf Serum (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Grace W. Chong, et al.,
bioRxiv - Microbiology 2019
Quote:
... and a peristaltic pump (Cole-Parmer Masterflex L/S Easy-Load II) was used to control injection of filtered air at a rate of 3.6 mL/min into the reactor ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
No products found
because this supplier's products are not listed.
Kenneth Johnson, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C in flow chambers (IBI scientific, UK). The system was sterilized by pumping a 0.2 % of hypochlorite solution for 1 hour using a peristaltic pump ...
-
No products found
because this supplier's products are not listed.
Lingling Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... feeder cells were treated with Mitomycin C (Apexbio Technology) at the concentration of 10 μg/mL for 2 hours and then washed with PBS ...
-
No products found
because this supplier's products are not listed.
Adam L. Fellows, et al.,
bioRxiv - Cell Biology 2023
Quote:
Confluent HPAECs were treated with CTC (Cambridge Bioscience, C-2951) at a concentration of 100μM (unless otherwise stated) ...
-
No products found
because this supplier's products are not listed.
Mathias Hutzler, et al.,
bioRxiv - Microbiology 2021
Quote:
... matured for 7 days at 10 °C and stabilized seven days at 0 °C before depth filtration (Seitz EK, Pall Corporation, New York, NY, USA). Prior to bottling ...
-
No products found
because this supplier's products are not listed.
Zhang Feng, Omar E. Alvarenga, Alessio Accardi,
bioRxiv - Biochemistry 2024
Quote:
... and resuspended in buffer C and 40 mM sodium cholate (Anatrace) at a final lipid concentration of 20 mM ...
-
No products found
because this supplier's products are not listed.
Rosa Machado, et al.,
bioRxiv - Biophysics 2019
Quote:
... we warmed the objective to 37 °C using an objective heater (Bioptechs). In some experiments we used a custom-made microscope incubation chamber ...
-
No products found
because this supplier's products are not listed.
Komal Soni, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... was homogenized at 4°C using 700 µL zirconia beads (BioSpec, 110791) in Precellys 24 homogenizer (Bertin Technologies ...
-
No products found
because this supplier's products are not listed.
Arnaud Rondelet, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and derivatives were grown at 5% CO2 and 37 °C in DMEM (PAN Biotech) supplemented with 10% filtered Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and Buffer C is the buffer recommended by the CleanCap® AG manufacturer (Trilink) for use with WT T7RNAP ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Zhuangzhuang Geng, et al.,
bioRxiv - Biochemistry 2021
Quote:
AP staining was performed using a Stemgent AP staining kit II (ReproCELL, cat# 00-0055). Cells were fixed with fixation solution for 5 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Naidi Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the body temperature of the mouse was maintained at 37 °C using a homeothermic monitoring system (No. 69020, RWD life science).
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
MULTI-ARRAY Standard 96-well plates (Meso Scale Diagnostics, Rockville, Maryland) were coated overnight at 4°C with K1 anti-dsRNA mouse monoclonal antibody (SCICONS, Budapest, Hungary). Plates were blocked using 5% MSD Blocker A (Meso Scale ...
-
No products found
because this supplier's products are not listed.
Jessica Moretti, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rabbit anti-c-Fos (1:2000, EnCor Biotechnology Inc., RPCA-c-Fos), 3% normal goat serum ...
-
No products found
because this supplier's products are not listed.
Carlos Gomez-Diaz, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF (Immunotools, 12343017), cycloheximide (CHX ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Marcos A.S. Fonseca, et al.,
bioRxiv - Genomics 2021
Quote:
... 60°C/4min on an AC4 thermal cycler (FroggaBio). 5-fold diluted pre-amplified DNA was used in multiplex ddPCR and subsequently individual-variant ddPCR for validation (if positive) ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Randy F. Lacey, et al.,
bioRxiv - Microbiology 2021
Quote:
... Oospore numbers were estimated using disposable C-Chip haemocytometers (Bulldog Bio). Purified oospores were stored at 4 °C in the dark.
-
No products found
because this supplier's products are not listed.
Eriko Ohgitani, et al.,
bioRxiv - Microbiology 2021
Quote:
... and RNA was extracted using TRI Reagent(C) LS (Molecular Research Center, Inc. ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Yurika Matsui, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... cells were incubated at 37 °C with reconstituted FAM-FLICA® at a 1:300 dilution (ImmunoChemistry Technologies 94) for 30 min ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...