-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Daniyal J Jafree, et al.,
bioRxiv - Pathology 2024
Quote:
... mouse monoclonal anti-platelet and endothelial cell adhesion molecule 1 (PECAM1/CD31 Aligent, GA610, clone: JC70A, 1:50) rabbit polyclonal anti-ssu-2 homolog (SSUH2, Atlas Antibodies, HPA049777, 1:100), rabbit polyclonal anti-fibulin 2 (FBLN2 ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Daniel Perez-Zsolt, et al.,
bioRxiv - Microbiology 2021
Quote:
... centrifuged to remove cellular debris and assayed with a SARS-CoV-2 Nucleocapsid protein (NP) High-sensitivity Quantitative ELISA (ImmunoDiagnostics). For degradation experiments ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Danya Abazari, et al.,
bioRxiv - Neuroscience 2022
Quote:
Protein palmitoylation assay was performed using CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), as described by manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Juan F. Codocedo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One portion of the homogenate was further sonicated for protein extraction and western blot and ELISA analysis and the other was stored at -80 °C in RNA bee (Amsbio, CS-501B) for RNA extraction and gene expression analysis.
-
No products found
because this supplier's products are not listed.
Emma V Parkins, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-PSD-95 MAGUK scaffold protein mouse monoclonal (Antibodies Incorporated Cat# 75-348, RRID:AB_2315909), Synapsin-1 rabbit polyclonal Sigma-Aldrich Cat# S193 ...
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Flore Oudouhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... The production of proteins was assessed with monoclonal mouse anti-Helicobacter pylori CagA (HyTest Ltd.) and rabbit Cagα antiserum (Abcam) ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
AL Chenery, et al.,
bioRxiv - Immunology 2020
Quote:
... fusion proteins were generated of mouse IL-4 and IL-13 with the Fc portion of IgG1 (custom order with Absolute Antibody). Mice were injected intraperitoneally with either PBS ...
-
No products found
because this supplier's products are not listed.
Peixiang Zhang, et al.,
bioRxiv - Physiology 2022
Quote:
... mice were maintained on mouse chow (diet D1001 containing 10 kcal% fat, 20 kcal% protein and 70 kcal% carbohydrate; Research Diets, New Brunswick, NJ) or chow containing simvastatin (0.1 g/Kg body weight in mouse chow ...
-
Cat# HY-K0701-5 Assays,
5 Assays, USD $480.0
Ask
Muhammad Jamal, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The protein signal in the membrane was detected by using an ultra-high sensitivity ECL kit (MedChemExpress, USA). Antibodies ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Dongying Chen, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... To harvest protein lysate from IBIDI µSlide ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Tomas C. Pascoa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... prior to denaturing intact protein mass spectrometry analysis the protein (2 mg mL-1) was incubated with 200 µM sphinganine (Avanti Polar Lipids), 200 µM fumonisin B1 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...