-
No products found
because this supplier's products are not listed.
Shajo Kunnath-Velayudhan, et al.,
bioRxiv - Immunology 2021
Quote:
... immunoglobulin-depleted FBS (10%; Atlanta Biologicals), β-mercaptoethanol (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and levels of the IgG1 Fc moiety were measured by Human IgG ELISA Kit (Immunology Consultants Laboratory). To characterize different routes side-by-side ...
-
No products found
because this supplier's products are not listed.
Chih-Cheng Huang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5′-Biotin-G-Monophosphate (TriLink, #N-6003) at a 20 mM (final concentration ...
-
No products found
because this supplier's products are not listed.
Lorenzo Iovino, et al.,
bioRxiv - Immunology 2021
Quote:
For the administration of TC-G 1008 (Tocris, Bristol, UK.), we followed a micropipette-guided drug administration protocol67 ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Weimin Zhang, et al.,
bioRxiv - Genomics 2022
Quote:
... and isolated serum was diluted 100-fold using the dilution buffer of a mouse anti-SARS-CoV-2 antibody IgG titer serologic assay kit (ACROBiosystems, RAS-T023). Diluted samples were added to a microplate with pre-coated SARS-CoV-2 Spike protein (2 μg/mL) ...
-
No products found
because this supplier's products are not listed.
Jinqiang Zhang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... for 24 h and the secondary antibodies (anti-rabbit IgG-conjugated Alexa Fluorochrome or anti-mouse IgG conjugated Alexa Fluorochrome, Invitrogen; 1:500) for 2 h at room temperature.
-
No products found
because this supplier's products are not listed.
Peiru Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Antibodies against GAPDH (CW0100) goat anti rabbit IgG-HRP (CW0103S) and goat anti-mouse IgG-HRP (CW0102) were from CoWin Biosciences (Taizhou, Jiangsu, China). Acetylated trypsin 38 were from Enzyme & Spectrum (Beijing ...
-
Mouse Immunoglobulin G (IgG) Chemiluminescent Immunoassay (CLIA) Kit is a Sandwich...
Cat# abx491627-10×96T,
10 × 96 tests USD $8482.5
Ask
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
The following kits were used for the qualitative determination of IgG class antibodies against human coronaviruses: abx052609 Human Coronavirus IgG ELISA kit (Abbexa, Cambridge, UK), against an undetermined antigen ...
-
No products found
because this supplier's products are not listed.
Alissa Muller, et al.,
bioRxiv - Neuroscience 2023
Quote:
... human or Abca4ms1961G/G wild-type mouse retinas were placed into a hybridization chamber (Grace Bio-Labs) and permeabilized inside the chamber for 15 min with 0.5% Triton X-100 in PBS ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The Ded1-IgG and SRP21-IgG were produced by Covalab using purified recombinant Ded1 or SRP21 ...
-
No products found
because this supplier's products are not listed.
Elke M. Muntjewerff, et al.,
bioRxiv - Physiology 2021
Quote:
... Mouse EIA kits from CUSABIO (CUSABIO Technology LLC, Houston, TX) were used to determine CgA (CSB-EL005344MO) ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
G-actin (Tebu bio) was stored in G-buffer (20 mM Tris-HCl pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml, clone MH16-1, Sanquin Reagents). After a final five-times wash ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Tomás Dias, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... or isotype IgG (orb343761, Biorbyt), by using the Dynabeads™ Antibody Coupling Kit whilst following the supplier’s instructions ...
-
LC Laboratories' Product Number C-2606 - CI-994, Free Base (Acetyldinaline; Goe 5549; GÀÜ...
Cat# C-2606, SKU# C-2606_5g,
5 g, $1350.00
Ask
Wenhui Wei, Alan V. Smrcka,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... gefitinib (LC Laboratories, Cat# G-4408), myristoylated PKA inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Zhaoqian Wang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μL of 0.6 mg/mL LayV G or 2 mg/ml LayV G with 0.01% fluorinated octyl-maltoside (Anatrace) detergent were applied onto a freshly glow discharged 2.0/2.0 UltraFoil79 grid (200 mesh) ...
-
No products found
because this supplier's products are not listed.
Robert VanBuren, et al.,
bioRxiv - Plant Biology 2019
Quote:
... A Hi-C library was constructed using 0.2 g of leaf tissue collected from newly emerged teff seedlings with the Proximo™ Hi-C Plant kit (Phase Genomics) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Doan C. Nguyen, et al.,
bioRxiv - Immunology 2023
Quote:
In-channel IgG capture assays were performed using single assay mixtures containing anti-human IgG-coated 6-8μm beads (Spherotech) and fluorescently-labeled detection anti-IgG antibodies (2.5μg/mL ...
-
No products found
because this supplier's products are not listed.
Alissa Shida, et al.,
bioRxiv - Biochemistry 2019
Quote:
... ACTH was measured using a mouse ACTH assay kit (FEK-001-21; Phoenix Pharmaceuticals, Inc., USA) [43,44] ...
-
No products found
because this supplier's products are not listed.
Mehdi Khadraoui, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... We provided all cages with 5 g/10 g (for small/large species, respectively) of compacted cotton (Nestlet, Ancare, Bellmore, NY, USA), ~10 g/30 g (small/large species ...
-
Cat# HY-P7068-10 μg,
10 μg, USD $190.0
Ask
Esther Arnaiz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... or 5μM gamitrinib-triphenylphosphonium (G-TPP, HY-102007, MedChemExpress).
-
No products found
because this supplier's products are not listed.
Stefan Haug, et al.,
bioRxiv - Genetics 2022
Quote:
... secondary antibody labeling and chromogenic development were performed using an ImmPRESS horseradish peroxidase Horse Anti-Rabbit IgG PLUS Polymer Kit (Vector Biolabs, MP-7800-15). After development ...
-
No products found
because this supplier's products are not listed.
David J. Speicher, et al.,
bioRxiv - Microbiology 2020
Quote:
... and RIDASCREEN® Mumps IgG (K5521) from R-Biopharm AG (Darmstadt ...
-
No products found
because this supplier's products are not listed.
Natalie S. Haddad, et al.,
bioRxiv - Immunology 2020
Quote:
... InvivoGen) and 6G9 (human:mouse chimeric IgG anti-N; Amsbio) were used as calibrators for SARS-CoV-2 antibody concentrations.
-
No products found
because this supplier's products are not listed.
Na Fei, et al.,
bioRxiv - Physiology 2023
Quote:
... Serum LBP level was measured by a Mouse Lipopolysaccharide Binding Protein ELISA Kit (HyCult Biotechnology, Uden, The Netherlands). All assays were performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Christopher P. Harper, et al.,
bioRxiv - Microbiology 2024
Quote:
... FailSafe PCR 2X PreMix D or G (LCG, Biosearch Technologies) were used as buffer for all PCR reactions.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Carlos Gomez-Diaz, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse TNF (Immunotools, 12343017), cycloheximide (CHX ...
-
Cat# AG002,
USD $49.0/3.0ml
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Shana Alexander, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Gel was casted by the addition of 2.4 g agarose (FroggaBio, Cat#A87) into 120 mL of 0.5x TBE ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 µl of secondary antibody (goat anti-human IgG Fc; Meridian Life Science) at a 1:4,000 dilution in blocking buffer was applied to each well for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Anna Mallach, et al.,
bioRxiv - Neuroscience 2023
Quote:
... AppNL-G-F mice and wildtype (WT) controls were sacrificed at 3 months (3M) and 18 months (18M ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Henrick Riemenschneider, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 4.5 g/L Glucose using an inverted LSM710 Axio Observer.Z1 confocal laser scanning system (Carl Zeiss) equipped with a Plan-Apochromat 63×/1.40 Oil DIC M27 objective ...
-
No products found
because this supplier's products are not listed.
David Mendes Costa, et al.,
bioRxiv - Microbiology 2022
Quote:
... Live sporozoites were centrifuged for 3 min at 450 x g in a 18-well µ-slide (ibidi), at room temperature ...
-
No products found
because this supplier's products are not listed.
Elise H. Zimmerman, et al.,
bioRxiv - Microbiology 2023
Quote:
... samples were centrifuged at 6,000 x g for 7 minutes then resuspended in RNAzol RT (Molecular Research Center). Samples then underwent RNA extraction ...
-
No products found
because this supplier's products are not listed.
Alec Fraser, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cells were then pelleted by centrifugation at 4,000 g for 10 min at 4°C and transferred to the SelenoMet Medium (Molecular Dimensions) that was supplemented with ampicillin at a concentration of 100 μg/mL ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...