-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adeno-associated viruses (AAV) obtained from SignaGen Laboratories, Maryland (AAV2-Synapsin-tdTOMATO ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Michelle Wintzinger, et al.,
bioRxiv - Physiology 2022
Quote:
... we followed general guidelines associated with the staining assay #KTMTR2LT (StatLab; McKinney, TX). Briefly ...
-
No products found
because this supplier's products are not listed.
Miryam Adelfio, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Gingival cells were maintained in culture up to passage 6 in appropriate medium supplemented with associated growth factor kits (Lifeline Cell Technology, Frederick, MD). For passaging cells ...
-
Cat# ANGPTL8-3898H,
25ug : USD $319
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Monika Moissidis, et al.,
bioRxiv - Neuroscience 2024
Quote:
... to stain cells infected with adeno-associated viruses expressing mCherry or against GFP (using a combination of two rabbit anti-GFP antibodies, 1:500, Aves Labs #GFP-1020 and Abcam #ab13970) to reveal the endogenous GFP signal of MGE-derived cells labeled with an RCE reporter ...
-
Cat# HY-P0181-1 mg,
1 mg, USD $132.0
Ask
Muhammad Jamal, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The protein signal in the membrane was detected by using an ultra-high sensitivity ECL kit (MedChemExpress, USA). Antibodies ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
S protein (Cube Biotech #28703) and isolated platelets were mixed at final concentrations of 0.2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Dongying Chen, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... To harvest protein lysate from IBIDI µSlide ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and anti-mouse (for HA; Covalab) were used as secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Kristine L Trotta, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was transferred to nitrocellulose (0.2µm; GVS) via semi-dry transfer with a TransBlot Turbo transfer system (BioRad ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Mingyu Fang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... gels were either stained with Coomassie (Protein Ark) or transferred to PVDF membranes for Western blot analysis.
-
No products found
because this supplier's products are not listed.
Kevin W. Bollinger, et al.,
bioRxiv - Microbiology 2024
Quote:
... and Ldt3 was raised against purified protein (ProSci). To analyze protein levels by Western immunoblotting ...
-
No products found
because this supplier's products are not listed.
Chiara Galante, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Red Fluorescent Protein (RFP, rabbit, 1:500, Biomol, 600401379S); SRY-Box 10 (Sox10 ...
-
No products found
because this supplier's products are not listed.
Hunter C. Davis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse was kept on a heating pad (WPI ATC2000) to maintain stable body temperature at 37 °C and its eyes were kept moist using ophthalmic eye ointment ...
-
No products found
because this supplier's products are not listed.
Kyoko Chiba, et al.,
bioRxiv - Biophysics 2021
Quote:
The purified proteins were analyzed using BioSep SEC-s4000 (Phenomenex) particle size 5 μm ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Cristina Márquez-López, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Nsp1 proteins were performed in 35-mm tissue culture dishes (MatTek) using the jetPRIME® reagent according to the manufacturer’s protocol (Polyplus transfection®) ...
-
No products found
because this supplier's products are not listed.
Robert R. Bowers, et al.,
bioRxiv - Genetics 2021
Quote:
... coli kit (MS-CRED-KIT) was purchased from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Shane Miersch, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Fifty micrograms of protein were injected onto a TSKgel BioAssist G3SWxl (Tosoh) fitted with a guard column using an NGC chromatography system and a C96 autosampler (Biorad) ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...