-
No products found
because this supplier's products are not listed.
Arielle L. Homayouni, et al.,
bioRxiv - Plant Biology 2024
Quote:
... sub-family C domains of ABCC10 and relatives were aligned with Lasergene MegAlign (DNASTAR) using the ClustalW default settings with the Gonnet series protein weight matrix ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Irina V. Chestakova, et al.,
bioRxiv - Microbiology 2023
Quote:
... were mixed with protein array buffer (Maine manufacturing, GVS Group, Italy) including 4 μl/ml EZ block™ protease inhibitor cocktail (Bio Vision ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Chan Cao, et al.,
bioRxiv - Biophysics 2023
Quote:
... EBCs were lysed and further treated using the Hemovoid kit (Biotech Support Group), aiming to remove hemoglobin (the most abundant protein in RBCs ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Qian Shi, et al.,
bioRxiv - Physiology 2022
Quote:
... anti-β2-adrenergic receptor (β2AR) (A-B2AR, Badrilla), anti-β1-adrenergic receptor (β1AR ...
-
No products found
because this supplier's products are not listed.
Tyng-An Zhou, et al.,
bioRxiv - Immunology 2022
Quote:
... C57BL/6 recipients were anesthetized by i.p injection of Ketamine hydrochloride (120 µg/g, Toronto Research Chemicals) and Xylazine hydrochloride (12 µg/g ...
-
No products found
because this supplier's products are not listed.
Angela M. Bosco-Lauth, et al.,
bioRxiv - Microbiology 2020
Quote:
... Positive control antibodies to the receptor-binding domain (RBD) and full-length spike protein were human MAb CR3022 antibody (Absolute Antibody, Oxford UK) and human IgG whole molecule (Jackson Immuno Research ...
-
No products found
because this supplier's products are not listed.
Luke L. Cai, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Fifty micrograms of protein were mixed with Laemmli SDS sample buffer (6×, Boston BioProducts) and heated at 95 °C for 10 min ...
-
No products found
because this supplier's products are not listed.
Yan Ni, et al.,
bioRxiv - Bioengineering 2020
Quote:
Cardiac Troponin I (8T53) and C-reactive protein (8C72) were purchased from Hytest. Anti-cetuximab (HCA221) ...
-
No products found
because this supplier's products are not listed.
Ruddi Rodríguez-García, et al.,
bioRxiv - Cell Biology 2019
Quote:
1 μm glass beads functionalized with carboxy groups (Bangs Laboratories) were conjugated with PLL-PEG (Poly-L-lysine (20 kDa ...
-
No products found
because this supplier's products are not listed.
Elahe Zarini-Gakiye, et al.,
bioRxiv - Neuroscience 2020
Quote:
... were mechanically isolated (after snap freezing in liquid nitrogen) from each experimental groups and total RNA was extracted using an easy-BLUE total RNA extraction kit (iNtRON Biotechnology, South Korea) and resolved in 50μl DEPS water ...
-
No products found
because this supplier's products are not listed.
Youri G Bolsius, et al.,
bioRxiv - Neuroscience 2021
Quote:
... both experimental groups were immediately sacrificed and the brains were impregnated using the Rapid Golgi stain kit (FD Neurotechnologies Inc., Columbia, MD, USA) and coronal 80μm thick hippocampal sections were prescreened to find neurons qualified for spine analysis ...
-
No products found
because this supplier's products are not listed.
Laura Cheradame, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Cell lysate protein concentration was determined using a Micro BCA Protein Assay kit (Bio Basic). Unless specified ...
-
No products found
because this supplier's products are not listed.
Larissa Mourao, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Paraffin-embedded sections were incubated for 60 min at 55 °C and de-paraffinized for 6 minutes in terpene (Histoclear, National Diagnostics) and rehydrated in 100% isopropanol ...
-
No products found
because this supplier's products are not listed.
Thibault Rosazza, et al.,
bioRxiv - Immunology 2020
Quote:
... and cultured for 6 days at 37°C in a 7.5% CO2 air atmosphere in complete DMEM medium (Pan Biotech – P04-03500) containing 4.5 g/L Glucose ...
-
No products found
because this supplier's products are not listed.
Marie S. Prevost, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The supernatant containing solubilized proteins was bound overnight at 4°C on a gravity flow Rho1D4 resin (Cube Biotech) equilibrated with buffer A supplemented with 0.05% DDM ...
-
No products found
because this supplier's products are not listed.
Kerri Spontarelli, et al.,
bioRxiv - Physiology 2023
Quote:
... The mouse temperature was held constant at 37 °C by a heating pad and an anal temperature probe (Kent Scientific). The hindlimbs of the mice were shaved and defolliculated to insert disposable sterile subdermal 13 mm needle electrodes (Friendship Medical) ...
-
No products found
because this supplier's products are not listed.
Takeshi Harayama, et al.,
bioRxiv - Genetics 2020
Quote:
... and 22:6-CoA (Avanti Polar Lipids), 110 mM Tris-HCl pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... SEA resin (0.16 mmol/g; Iris Biotech) was weighed out ...
-
No products found
because this supplier's products are not listed.
Jin Hu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... primary microglia of indicated groups were cultured in heat-inactivated DMEM medium containing 5 μM Fluo-4 AM (AAT Bioquest), 0.4 % F-127 (Beyotime ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Paresh P Kulkarni, et al.,
bioRxiv - Cell Biology 2023
Quote:
Protein C activity in WT and Apoh-/- plasma was performed using the Chromogenix Coamatic Protein C activity kit (Diapharma). Briefly ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Katherine Minjee Chung, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... metformin (2 mg/mL, Spectrum Chemical Group), and proglumide (0.1 mg/mL ...
-
No products found
because this supplier's products are not listed.
Nicola Schmidt, et al.,
bioRxiv - Genomics 2023
Quote:
... accession number OY726583) marking an intercalary satDNA family (Kubis et al., 1998) was directly labeled with DY415-dUTP (Dyomics). The probe ‘pTS4.1’ for the pericentromeric satDNA in Patellifolia species (Schmidt et al. ...
-
No products found
because this supplier's products are not listed.
Kerrie L. Marie, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Lot# CA36131)/ 1:400 KDEL Receptor 3 (L95) polyclonal (Bioworld Technology Cat# BS3124 ...
-
No products found
because this supplier's products are not listed.
Sanna Hellberg, et al.,
bioRxiv - Physiology 2020
Quote:
... and Phospholipids C kit (Fujifilm, Wako Diagnostics), respectively.
-
No products found
because this supplier's products are not listed.
Seraina A. Domenig, et al.,
bioRxiv - Cell Biology 2023
Quote:
... at 37°C using DirectPCR Lysis Reagent (mouse tail) (VIG102-T, Viagen Biotech). PCR for Pax7-nGFP was performed using primer Pax7nGFP.F/ Pax7nGFP.R and GoTaq G2 Hot Start Green Master Mix (M7423 ...
-
No products found
because this supplier's products are not listed.
Baruh Polis, et al.,
bioRxiv - Neuroscience 2019
Quote:
... male 4-month-old transgenic mice and age-matched male C57Bl/6 mice (wild-type) were divided into four groups (10 mice in each group) and housed in individually ventilated cages (Lab Products Inc., Seaford, DE, USA), with five mice per cage ...
-
No products found
because this supplier's products are not listed.
Kazusa Takeda, et al.,
bioRxiv - Biophysics 2022
Quote:
... The supernatant obtained after lysate centrifugation (17,800 × g, 15 min, 4°C) was applied to a Toyopearl DEAE-650M column (Tosoh, Tokyo, Japan) equilibrated with the same buffer ...
-
No products found
because this supplier's products are not listed.
Logan D. Morton, et al.,
bioRxiv - Bioengineering 2022
Quote:
Peptides were synthesized using Rink Amide polystyrene resin (0.43-0.49 mmol/g, Chem- Impex International, Inc.) on a Prelude X automated peptide synthesizer (Gyros Protein Technologies). Traditional Fmoc-mediated coupling methods were used at five-fold molar excess of amino acids and O-(1H-6-Chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Dennis M Defoe, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated overnight at 4°C in combined primary antibodies (chicken anti-green fluorescent protein [GFP]; Aves Labs, Tigard ...
-
No products found
because this supplier's products are not listed.
David López-Rodríguez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 55°C for 30sec and 72°C for 1min sequencing libraries were prepared using the NETflex DNA Sequencing Kit (BIOO Scientific, Austin, TX) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qiyue Ding, et al.,
bioRxiv - Biochemistry 2020
Quote:
Protein thiol redox states were monitored using the -SulfoBiotics- Protein Redox State Monitoring Kit Plus (Catalog # SB12; Dojindo Molecular Technologies). Samples were labeled with the Protein-SHifter Plus in accordance with the manufacturer’s instructions ...
-
CytoSoft® products provide a tool to culture cells on PDMS substrates with various rigidity...
Cat# 5190-7EA,
6 well, USD $215.0
Ask
Colin D. Paul, et al.,
bioRxiv - Bioengineering 2019
Quote:
Cytosoft 6-well plates (Advanced BioMatrix, San Diego ...
-
No products found
because this supplier's products are not listed.
Chamitha Weeramange, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 0.2% glucose (Teknova, G-5802) or glycerol (Fisher-56-81-5 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Rebecca N. Lopez-Anido, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... fine forceps (Dumont #6, Fine Science Tools) were used to gently depress the foot from the shell deck followed by gentle pulling on the foot to remove the remaining organs found within the mantle cavity of the shell ...
-
No products found
because this supplier's products are not listed.
Miles H. Black, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 50 μM 6-biotin-17-NAD+ (Trevigen). Reactions were incubated at 37 °C for 15 minutes ...