-
No products found
because this supplier's products are not listed.
Abir Mukherjee, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 million stable SKOV3ip1 cells (transduced with either control shRNA or shRNA targeting HIF1α) were injected into female athymic nude mice (Envigo), and tumors were allowed to establish for 4 weeks ...
-
No products found
because this supplier's products are not listed.
David V.C. Brito, et al.,
bioRxiv - Neuroscience 2020
Quote:
... we used adult male C57BL/6N mice that were 8 weeks old at the time of surgery [(MeCP2-shRNA (n=8) or Control-shRNA (n=8)] (Charles River, Sulzfeld, Germany). The mice were group-housed on a 12h light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Yuanjun Shen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... siRNAs and shRNAs were purchased from Dharmacon (PerkinElmer, Waltham, MA) and Santa Cruz Biotechnology (Dallas ...
-
No products found
because this supplier's products are not listed.
Emily Hansen, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cells expressing the various shRNAs were selected with 0.2 mg/ml hygromycin (cat#K547-20ml, VWR) at 72-hours post transfection and maintained at 0.8 mg/ml of hygromycin after cell line purification.
-
No products found
because this supplier's products are not listed.
Maria V. Sinegubova, et al.,
bioRxiv - Biochemistry 2020
Quote:
... plasmid # 162785 Plasmids for cell transfections were purified by the Plasmid Midiprep kit (Evrogen, Moscow, Russia) and concentrated by ethanol precipitation in sterile conditions.
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Mouse TrueBlot ULTRA (anti-Mouse Ig (Rockland) secondary antibody ...
-
No products found
because this supplier's products are not listed.
Arja Ray, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1:200 rat anti-mouse CD31 (Dianova, Mouse), 1:400 rabbit anti-CD31/PECAM-1 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Danielle N. Gallagher, et al.,
bioRxiv - Genetics 2020
Quote:
... Plasmids were verfieid by sequencing (GENEWIZ) and transformed as previously described80.
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse Gephyrin (1:1000, Synaptic Systems, catalog #147021), Neuroligin-1 (1:300 ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CENP-A (mouse mAb, AbCam, ab13939; mouse mAb, GeneTex, GTX13939), CENP-C (guinea pig pAb ...
-
No products found
because this supplier's products are not listed.
Alejandro Prieto, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse IgA (Bethyl) was used as a standard for the determination of total IgA ...
-
No products found
because this supplier's products are not listed.
Iulia Rusu, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant mouse IL-1β and mouse LIGHT were purchased from Peprotech. Pam3CSK4 ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... mouse anti-KCNMA1 (Abnova), mouse monoclonal anti-Na+/K+-ATPase β1 subunit (Sigma ...
-
No products found
because this supplier's products are not listed.
Hana Sedlackova, et al.,
bioRxiv - Cell Biology 2019
Quote:
... MCM2 (mouse, Novus Biologicals, H000041171-M01 ...
-
No products found
because this supplier's products are not listed.
Maitreyi Rathod, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse DSG1 ((#651111 Progen), rabbit keratin 10 (#905403 Biolegend) ...
-
No products found
because this supplier's products are not listed.
V Paradise, et al.,
bioRxiv - Neuroscience 2022
Quote:
Stable RAP expression plasmid was obtained from Kerafast (EMD008) and was transformed into T7 Express lysY Competent E ...
-
No products found
because this supplier's products are not listed.
Liqiao Hu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Plasmids were transfected using the HighGene Transfection Reagent (ABclonal). HeLa cells were transfected using Lipofectamine 2000 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Zhicong Chen, et al.,
bioRxiv - Cancer Biology 2022
Quote:
LIPA shRNA lentivirus was purchased from GenTarget Inc (USA) ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... HUVECs expressing the shRNAs were plated in μ-Slide VI 0.4 (80606; IBIDI) at a density of 30,000cells per channel in starving medium (EBM+0.5%serum+doxy+puro) ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, Darren Diaz, Jarrod J. Mousa,
bioRxiv - Immunology 2020
Quote:
... Plasmids were purified using the EZNA plasmid maxi kit (Omega BioTek), according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Benjamin H. Weinberg, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... plasmid DNA was isolated using mini plasmid preparation (Epoch Life Science). Analytical digests with MluI/BspEI were performed and run on gel electrophoresis to assay if a correct product was made ...
-
No products found
because this supplier's products are not listed.
Wiktoria Ogrodzińska, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
No products found
because this supplier's products are not listed.
Coraline Mercier, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasmid extraction was performed with ISOLATE II Plasmid Mini Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicolas Tricaud, et al.,
bioRxiv - Neuroscience 2019
Quote:
... the U6-VDAC1-shRNA sequences were then cut using ApaI and BstEI to be cloned into a pAAV-CMV-GFP vector (Cell Biolabs, Inc.), the pAAV-mito-GCaMP2 ...
-
No products found
because this supplier's products are not listed.
Marco Thürkauf, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... plasmid using PEI MAX (Polyscience). For small or large AAV preparations ...
-
No products found
because this supplier's products are not listed.
Juanita C. Limas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Plasmids were validated via sequencing (Eton Biosciences) for the desired insert using appropriate primers.
-
No products found
because this supplier's products are not listed.
Théo Juncker, et al.,
bioRxiv - Immunology 2023
Quote:
... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
No products found
because this supplier's products are not listed.
Tara A. Gleeson, et al.,
bioRxiv - Immunology 2024
Quote:
... mouse-anti-mouse NLRP3 (1/1000 dilution; Cryo2, Adipogen, AG-20B-0014), rabbit-anti-mouse gasdermin-D (1/1000 dilution ...
-
No products found
because this supplier's products are not listed.
Mitsugu Shimobayashi, et al.,
bioRxiv - Physiology 2020
Quote:
Plasma Leptin levels were measured by mouse mouse Leptin ELISA kit (Crystal Chem) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... mouse anti-TH (Immunostar 22941) 1:300 ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse-anti-H2BK120ub (Active Motif). Then ...
-
No products found
because this supplier's products are not listed.
Teresa L. Mastracci, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-CD4 (Leica; 1:500). Secondary antibodies including Alexa-488 ...
-
No products found
because this supplier's products are not listed.
C López-Haber, et al.,
bioRxiv - Cell Biology 2020
Quote:
Recombinant lentiviruses encoding shRNAs were produced by co-transfection of 293T cells (obtained from American Type Culture Collection, Mannassas, VA) with packaging vectors pDM2.G and pSPAx2 using calcium phosphate precipitation (Marks et al ...
-
No products found
because this supplier's products are not listed.
Brandon Cieniewicz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... the lentiviral plasmid was combined with three packaging plasmids encoding VSV-G (Aldevron, Cat# 5037-5), gag/pol (Aldevron ...
-
No products found
because this supplier's products are not listed.
Juntao Yu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Mouse PBMCs were purified from mouse whole blood by Mouse PBMC Isolation Kit (Solarbio, Beijing, China). All the mentioned cell lines were maintained under sterile conditions and cultured at 37°C in a 5% CO2 environment.
-
No products found
because this supplier's products are not listed.
Vukasin M. Jovanovic, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse astrocytes (ScienCell) and hPSCs were plated onto Geltrex coated 96 well plates (Corning ...
-
No products found
because this supplier's products are not listed.
Lipsa Panda, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse RXRγ (MyBioSource), Human RXRγ ...
-
No products found
because this supplier's products are not listed.
Bre-Anne Fifield, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... which were diluted with Mouse on Mouse (MOM) blocker (Biocare Medical). Primary antibodies used were as follows ...
-
No products found
because this supplier's products are not listed.
Sanduni I. Fernando, et al.,
bioRxiv - Biophysics 2023
Quote:
... anti-mouse CF568 (Biotium), and Phalloidin-Alexa Fluor 488 (Thermo-Fisher ...
-
No products found
because this supplier's products are not listed.
Andrew W. DeVilbiss, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse Ter119 (APC, Tonbo Biosciences) and human HLA-A ...
-
No products found
because this supplier's products are not listed.
Charles C. Reed, et al.,
bioRxiv - Immunology 2021
Quote:
... (MabTech, Mouse IFNγ ELISpot Plus). Cells were washed off ...
-
No products found
because this supplier's products are not listed.
Julie Chang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Rac1 (Cytoskeleton.com; ARC03; mouse monoclonal), Cdc42 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Hitoshi Watanabe, et al.,
bioRxiv - Physiology 2022
Quote:
... insulin with a Mouse (Mercodia,) or Human Insulin ELISA kit (both from Mercodia ...
-
No products found
because this supplier's products are not listed.
Nishit Goradia, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse IgG (Diagenode, C15400001, Belgium) or rabbit IgG (Diagenode ...
-
No products found
because this supplier's products are not listed.
Nuno Apóstolo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were placed in a mouse stereotact (KOPF) equipped with a neonatal mouse adaptor (Stoelting). During the rest of the procedure 2.5% isoflurane was constantly administered ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-Actin (69100; MP Biomedicals), and mouse anti-G3BP1 (sc-81940 ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
No products found
because this supplier's products are not listed.
Shusei Yoshida, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse anti-α-Tubulin (Cedarlane, CLT9002), and rabbit monoclonal anti-UbK48 (Millipore ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...