-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 µg/mouse of IL-15 (Shenandoah Biotech) was injected three times per week with an intraperitoneal injection (ip) ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... and 1 µg of mouse E2 (UBE2E3, Boston Biochem) in 40 µl of reaction buffer (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... The purified viruses were quantified by solid-phase indirect ELISA (Supplementary methods) and tested in an Octet RED bio-layer interferometer (Pall ForteBio, California, CA, USA) for receptor binding against sialoglycopolymers - α2,3-α1-4(6-HSO3)GlcNAc (3SLN(6-su)) ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Dinh-Vinh Do, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas Dal Maso, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mouse genotyping was performed with WONDER Taq Hot START (Euroclone) using the following primers ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Anqi Yu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
RNA was isolated from mouse subcutaneous tumors (six TOB1-AS1 overexpression and six control mice) after 6 weeks of PANC-1 cell subcutaneous injection using Direct-zol RNA Miniprep kit (RPI, ZR2052). Quality and quantity of the RNA was assessed using Qubit ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was intraperitoneally injected with 100 mg/kg BrdU (APExBIO, Houston, TX, USA) dissolved in saline ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Ann-Kathrin Vlacil, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1% P/S in fibronectin (1 µg/mL, Promocell) coated T75 flasks (Sarstedt ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... prepared as a 1:1 mixture of DMEM/F12 (PAN Biotech) and Neuropan basal medium (PAN Biotech ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...