-
No products found
because this supplier's products are not listed.
Rahul Chadda, et al.,
bioRxiv - Biophysics 2023
Quote:
... coli cells transformed with the expression plasmid were lysed by sonication and the protein extracted from membrane fragments into 2% n-Decyl-β-D-Maltopyranoside (DM; Anatrace, Maumee OH) containing 5 mM TCEP (Tris (2-carboxyethyl ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Alissa Muller, et al.,
bioRxiv - Neuroscience 2023
Quote:
... human or Abca4ms1961G/G wild-type mouse retinas were placed into a hybridization chamber (Grace Bio-Labs) and permeabilized inside the chamber for 15 min with 0.5% Triton X-100 in PBS ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
CP Profaci, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Three hours after CNO injection the mice were live-decapitated using a mouse decapitator (LabScientific, XM-801) and brain endothelial cells were isolated for RNA sequencing.
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Hanako Ono, et al.,
bioRxiv - Genomics 2019
Quote:
Cultured mouse organoids derived from a single cell were harvested and treated with Accumax (Innovative Cell Technologies, AM105) to generate a single-cell suspension ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Jared D. Chrispell, Yubin Xiong, Ellen R. Weiss,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit polyclonal antibodies against zebrafish Grk7 (27) and phosphorylated mouse Grk1 (17) were generated by 21st Century Biochemicals (Marlboro, MA, USA). A novel rabbit polyclonal antibody against phosphorylated zebrafish GRK1 was also generated by 21st Century Biochemicals using the peptide ISARG[pS]FDGTAN corresponding to amino acids 16-27 of zebrafish Grk1a ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 20-24 mice whose tumor volume had reached ∼250 mm3 (mouse grafts) or ∼80 mm3 (human grafts) at week two after grafting received either 10 mg/kg enzalutamide (TargetMol T6002) or 0.5% DMSO (MilliporeSigma D2650 ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
Cat# Serpine2-2599M,
50ug : USD $319
Ask
Daniela Esser, et al.,
bioRxiv - Neuroscience 2023
Quote:
... male and female) were immunized twice with Recombinant Mouse CNTNAP (>95% purity) and LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
because this supplier's products are not listed.
Malene E Lindholm, et al.,
bioRxiv - Genetics 2020
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from newly born rats using the neonatal rat/mouse cardiomyocyte isolation protocol from Cellutron (nc-6031) according to the specifications from the manufacturer ...
-
No products found
because this supplier's products are not listed.
Kryslaine L. Radomski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Twenty-to-fifteen representative images from each mouse were collected at 5,000x magnification using a JEOL JEM-1011 TEM (JEOL USA Inc., Peabody, MA) and an AMT XR50S-A digital camera (Advanced Microscopy Techniques ...
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
Goat polyclonal antibody specific for mouse IgG, purified by affinity chromatography
Cat# PAB21441-1000,
1.0 mg USD $179.8
Ask
Mathieu Ferrari, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were washed with 0.05% v/v PBS-Tween and sequentially incubated with mouse anti-SARS-CoV-2 N protein antibody (The Native Antigen Company – MAB12183-100) at 1:500 dilution and HRP-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch – 115-035-146 ...
-
No products found
because this supplier's products are not listed.
Domenico Viola, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with 100 μl of the D-Luciferin solution at a final dose of 3 mg/20 g mouse body weight (Biosynth, Cat. No. L-82220) and then gas-anaesthetized with isoflurane (Faulding Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Deniz Conkar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and mouse kidney medulla collecting duct cells IMCD3:Flip-In cells were cultured with DMEM/F12 50/50 medium (Pan Biotech, Cat. # P04-41250), supplemented with 10% FBS and 1% penicillin-streptomycin ...
-
No products found
because this supplier's products are not listed.
Erica L. Stone, et al.,
bioRxiv - Immunology 2021
Quote:
... blocks were cut in 5 μm sections that were placed on glass slides for anti-IgG (UltraPolymer Goat anti-Mouse heavy and light chain IgG-HRP, Cell IDx, San Diego, CA, USA) or anti-C3 (EPR19394 ...
-
The BNIP2 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between...
Cat# 1339301.0,
1.0 μg DNA, BC002461; 1.0 μg DNA, NM_016787; 1.0 μg DNA, NM_001008238; 1.0 μg DNA, NM_001106835, Inquire
No citation found on bioRxiv
-
BNIP2 Fragment MS Protein Standard, is a protein fragment containing a 50-150 amino acid...
Cat# CPILF26239,
inquiry, contact supplier for pricing
No citation found on bioRxiv
-
Cat# Ovs-060,
1 vial, USD $2,394
No citation found on bioRxiv
-
Cat# ACM93384180,
Inquire
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Catalog Number: B2013058 (1 Unit)
Lentivirus Control Plasmid is a high quality lentiviral...
Cat# B2013058,
USD $595.0
No citation found on bioRxiv
-
Prothrombin is a vitamin K-dependent plasma protein which is synthesized in the liver. Prior to...
Cat# CZY-026,
100 ug, contact supplier for pricing
No citation found on bioRxiv
-
No citation found on bioRxiv
-
NZO inbred mice and strains derived from them develop severe obesity, and are thus useful for...
Cat# DMM-001219,
Inquiry
No citation found on bioRxiv
-
Cat# IT-89-100,
100 micrograms,USD $1320.0
No citation found on bioRxiv
-
A unique collection of 158 mouse metabolites used for high throughput screening(HTS) and high...
Cat# L8900, SKU# L8900-100uL/well,
100uL/well, $3160.00
No citation found on bioRxiv