-
No products found
because this supplier's products are not listed.
Jimmy Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... The antibodies used for immunostaining and ELISA were mouse anti-Meth antibody (mouse, 10M25A Fitzgerald), anti-MBD2 (ab45027 ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Mei Zhang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Freshly dissected mouse brains were incubated in Golgi solution A and B (FD Rapid GolgiStain Kit, FD NeuroTechnologies) for 10 days ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
V.M. Stepanova, et al.,
bioRxiv - Molecular Biology 2023
Quote:
gDNA for T and CD45Δ T cells was obtained with an ExtractDNA Blood & Cells Kit (Evrogen, Russia) on the 2nd day after knockout ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
Wu Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The amount of time that the mouse interacted with the objects (T) was recorded using a wireless keyboard (ANY-maze, Stoelting). The preference index of interaction was calculated as Tnovel object/(Tfamiliarobject + Tnovel object).
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Xiao Du, et al.,
bioRxiv - Genomics 2020
Quote:
... (b) All SVs detected by PacBio CCS Reads and supported by either PacBio CLR or ONT were retained ...
-
No products found
because this supplier's products are not listed.
Denis Korneev, et al.,
bioRxiv - Cell Biology 2020
Quote:
Carbon Paint (Ted Pella, DAG-T-502)
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Yunfan Bai, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 μL of IS B (Avanti Polar Lipids Inc.) containing 1.0 nmol monoacylglycerol (MG ...
-
No products found
because this supplier's products are not listed.
Antti M. Salo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse skin and kidneys using E.Z.N.A total RNA kit I (Omega Bio-Tek) for cells and TRIzol (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Aikaterini Kalamari, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... except for 7 pairs of males from pilot experiment B that originated directly from Charles River. Only male rats were included in the experiments ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
P. Soblechero-Martín, et al.,
bioRxiv - Neuroscience 2021
Quote:
... aiming to skip DMD exon 51 (51-[T*C*A*A*G*G*A*A*G*A*T*G*G*C*A*T*T*T*C*T]-3⍰, Eurogentec, Belgium) by transfection with Lipofectamine as described in43,44 and analysed by either myoblot (96 well plates ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Elisa Arthofer, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... T cells were electroporated in Neon Buffer T with 15μg Cas9 mRNA (TriLink) and 10μg total sgRNA (Synthego ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Bettina Budeus, et al.,
bioRxiv - Immunology 2020
Quote:
Human lymphocytes or hematopoietic precursor cells were isolated by Ficoll density centrifugation (density 1.077 g/ml, Pan BioTech, Aidenbach, Germany) followed by selection of CD19- ...
-
No products found
because this supplier's products are not listed.
M. Zeeshan Chaudhry, et al.,
bioRxiv - Microbiology 2021
Quote:
... The blots were then incubated over night at 4 °C with primary antibody solution (all antibodies were diluted in PBS-T containing 5 % skim milk; mouse anti-HA tag [Sigma-Aldrich, H3663, 1:2,500] or VSV matrix protein [Kerafast, EB0011, 1:2,500]). Following this incubation ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
MI Oliveira da Silva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in TBS-T or 5%BSA (NZYTech) in TBS-T for 1 h at RT ...
-
HDL/LDL Assay Kit (EHDL-100)
Cat# EHDL-100,
1.0 kit, 100 tests, USD $409.0
Ask
Yehezqel Elyahu, et al.,
bioRxiv - Immunology 2024
Quote:
... The levels of AST and ALT in murine serum were measured using EnzyChrom™ ELISA kits for AST and ALT (BioAssay Systems) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Finja Bohle, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Membranes were washed three times with TBS-T for 5 min and incubated for 1 h in the secondary antibody (Goat anti-Mouse, Agrisera, AS11 1772, 1:2500 in TBS). For immunodetection the Agrisera ECL kit (Super Bright ...
-
No products found
because this supplier's products are not listed.
Maria Ninova, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... S2 cells were transfected with T ransIT-LT1 (Mirus). 24-48h post transfection cells were harvested and lysed in lysis buffer (20 mM Tris-HCl at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Jingxia Lu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the SpaKC sample was loaded to column B (Nanotemper MO-L011) and eluted with 450 μL of assay buffer (50mM Na2CO3/NaHCO3 ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Wener Li, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... cells were incubated with 1 mg/ml collagenase B (Worthington Biochemical) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Matthias Hose, et al.,
bioRxiv - Immunology 2022
Quote:
Isolated CD8+ T cells were plated in ibidi µ-slides (Ibidi, Gräfelfing, Germany) and stimulated with CD3/CD28 MACSiBead Particles (Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... mouse anti-TH (Immunostar 22941) 1:300 ...
-
No products found
because this supplier's products are not listed.
Fabio Palmieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... in BronchiaLife™ B/T complete medium (Lifeline Cell Technology, USA) supplemented with 0.5% Phenol Red solution (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
F. Javier Aguado, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 100-T Zymolyase (AMSBIO) was added to a final concentration of 1 mg/mL and incubated at 30°C for an additional 10 min ...
-
No products found
because this supplier's products are not listed.
Nikola Cousin, et al.,
bioRxiv - Immunology 2021
Quote:
OT-1 effector T cells were generated by ex vivo culture of total Ly5.1+ OT-1 splenocytes in T cell medium supplemented with 1 ng/ml SIINFEKL peptide and 100 U/ml recombinant mouse IL-2 (ImmunoTools) for 72 h ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Gadisti Aisha Mohamed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Slides were washed in TBS + 0.1% tween (TBS-T) and blocked in Antibody Diluent/Block (Akoya Biosciences, ARD1001EA) for 30 minutes at RT ...