-
No products found
because this supplier's products are not listed.
Alícia C. Piffer, et al.,
bioRxiv - Immunology 2021
Quote:
... with heat-inactivated Staphylococcus aureus (5×107 cells/mL) resuspended in Endothelial medium (C-22210, PromoCell) complemented with 10% of fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
M Niklas, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Srinu Tumpara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... allophycocyanin (APC)-conjugated mouse monoclonal anti-CD16 antibody (clone 3G8, Immunotools, Friesoythe, Germany), or BV-480 conjugated anti-CD56 mouse monoclonal antibody (Clone NCAM16.2 ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
Chromatographically purified according to Drapeau et.al, J. Biol. Chem., 247, 6720 (1972)....
Cat# LS02126,
5x10 ug, $192.00
Ask
Iwona Wojcik, et al.,
bioRxiv - Immunology 2020
Quote:
Endoproteinase Gluc-C (Staphyloccoccus aureus Protease V8) and chymotrypsin were obtained from (Worthington Biochemical Corp., Lakewood, USA). The ultrapure milli-Q deionized water (MQ ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... A primary mouse antibody α-C4c (Quidel) was diluted to 1:10,000 followed by a secondary goat α-mouse antibody conjugated to horseradish peroxidase (Thermo Scientific ...
-
WB,IF,IP,IHC,FC,ELISA
Cat# A5712, SKU# A5712-20ul,
20ul, $47.00
Ask
Hongcheng Tang, Jiafeng Zhu, Shuyan Wu, Hua Niu,
bioRxiv - Microbiology 2022
Quote:
... The eluates were further purified with magnetic beads conjugated with mouse anti-FLAG antibody (Bimake, Shanghai, China) (15 μL/dish) ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
Cat# HY-P1349-500 μg,
500 μg, USD $190.0
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Aubin Moutal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or VEGF-B (1nM, Cat#RPU44324, Biomatik) for 30 min before recording ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Cindy F. Yang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-somatostatin-14 antibody (Peninsula Laboratories, Cat# T-4103.0050, RRID: AB_518614) was raised in rabbit against the first 14 aa of the synthetic peptide SST ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
No products found
because this supplier's products are not listed.
Magda Luciana Atilano, et al.,
bioRxiv - Neuroscience 2022
Quote:
... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
No products found
because this supplier's products are not listed.
Grigoria Spanou, et al.,
bioRxiv - Microbiology 2023
Quote:
... aureus on Baird Parker Agar Base (Neogen, USA) with egg yolk tellurite at 37°C for 48h ...
-
Cat# F107,
USD $169.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Aysegul Ates, Cihan Tastan, Safak Ermertcan,
bioRxiv - Microbiology 2024
Quote:
... aureus strains was performed using Nucleospin Microbial DNA kit (Macherey-Nagel, Germany). In order to examine the mutation caused by the CRISPR/Cas system in the target gene regions ...
-
No products found
because this supplier's products are not listed.
Christopher R. Brown, James D. Foster,
bioRxiv - Neuroscience 2024
Quote:
... anti-mouse NET-05 and anti-human NET17-1 antibodies were from Mab Technologies. N-ethylmaleimide (NEM) ...
-
No products found
because this supplier's products are not listed.
Dongzhu Ma, et al.,
bioRxiv - Microbiology 2019
Quote:
... aureus samples by following manufacturer’s instructions (MasterPure gram positive DNA Purification Kit; Lucigen, USA). Briefly ...
-
This antibody is a recombinant mouse monoclonal antibody which specifically reacts with...
Cat# MOB-0205MZ,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Rania Akkawi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by incubation with secondary anti-mouse immunoglobulin antibody for 30 min (Nichirei Biosciences). The reaction was then performed using a DAB peroxidase kit (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Raissa R. Christoff, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the following primary antibodies were incubated overnight: mouse anti-SATB21:200 (GenWay 20-372-60065); rabbit anti-PH3 1:500 (Millipore 06-570) ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... samples were incubated with primary antibody solutions diluted in blocking buffer including mouse anti-5-mC (1:2000; Epigentek) and rabbit anti-PV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Dean Walsh, et al.,
bioRxiv - Microbiology 2023
Quote:
... aureus were diluted in BHI to OD600 0.05 and loaded into μ-slide 8-well glass bottomed chambers (ibidi, glass bottom). 500 ng/mL triclosan ...
-
No products found
because this supplier's products are not listed.
Jingyu Diao, et al.,
bioRxiv - Microbiology 2020
Quote:
... The anti-OmpA (Antibody Research Corporation), anti-GroEL (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Iwona Wojcik, et al.,
bioRxiv - Immunology 2020
Quote:
... FcγRIII were immunoprecipitated from the neutrophil cell lysate using a mouse anti-CD16 monoclonal IgG2a antibody (Ref M9087, Clone CLB-FcR gran/1, 5D2, Sanquin, Amsterdam, The Netherlands). Prior to usage ...
-
No products found
because this supplier's products are not listed.
Arjun Kalvala, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and anti-CD81 antibodies (System Biosciences, CA).
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Deanna N. Edwards, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Ad-CMV-b-Gal (Vector Biolabs #1080) or Ad-CMV-Null (Vector Biolabs #1300 ...
-
No products found
because this supplier's products are not listed.
Zhixin Cyrillus Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Quantum Simply Cellular (QSC) anti-mouse beads (Bangs Laboratories Ltd.) with known binding capacities for mouse IgG were used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Lisa C Green, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and stained with Picrosirius Solution B (Polysciences, 24901B) for one hour at room temp ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
Staphylococcus aureus Enterotoxin B Antibody is a Mouse monoclonal antibody for infectious...
Cat# abx022252-1MG,
1 mg USD $826.5
Ask
Isabel Brandão, et al.,
bioRxiv - Physiology 2023
Quote:
... the primary antibody was a rabbit polyclonal anti-PXDN antibody (Abbexa; Cambridge, UK; catalog # abx101906), purified by antigen-specific affinity chromatography ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Pilar X. Altman, et al.,
bioRxiv - Immunology 2024
Quote:
... BLI assays to detect tyrosine sulfation by binding antibodies with anti-sulfotyrosine antibodies were performed using polypropylene black 384-well microplate (Greiner) at 30°C in octet buffer (0.05% Tween in PBS) ...
-
No products found
because this supplier's products are not listed.
Rafael E. Sanchez-Pupo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Granzyme B imaging was performed in an LSM 800 Confocal Microscope (Carl Zeiss) using a Plan-Apochromat LCI Plan-Neofluar 25x (0.8 Imm Korr Water DIC ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...