-
No products found
because this supplier's products are not listed.
Michael J Massare, et al.,
bioRxiv - Immunology 2021
Quote:
... pBac1 plasmids were transfected into Sf9 with Flash-bacGOLD bacmid containing the Autographa californica polydedrosis virus genome (Oxford Expression Technology, Oxford UK). Sf9 cells cultures were infected with recombinant baculovirus expressing the HA genes ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2% Culture-Boost (Cell Systems), and 10% Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Gwen R. Buel, et al.,
bioRxiv - Biophysics 2022
Quote:
... and incubated with 2 mM DSP (ChemScene CS-0068460 ...
-
No products found
because this supplier's products are not listed.
Julio C.Y. Liu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... ML-792 (SUMOi; 2 μM, MedKoo Biosciences), MLN-7243 (Ub-E1i ...
-
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Acrylate-mPEG (Ac-mPEG, 2 kDa) and acrylate-PEG-maleimide (Ac-PEG-Mal, 2 kDa) were acquired from Biochempeg Scientific Inc ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Hironobu Endo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... desmethyl precursor of 11C-PBB3 (Nard Institute, NP076-2), desmethyl precursor of 11C-PE2I (Nard Institute ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Camila Ribeiro, et al.,
bioRxiv - Plant Biology 2020
Quote:
... plants were painted with a 2% glufosinate-ammonium (Bio-world), and non-transgenic segregants were removed (56) ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Jorge Antolio Domínguez-Bautista, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2% bovine serum albumin suitable for cell culture (RMBIO BSA-BAF-25G), and antibiotic/antimycotic (Life Technologies ...
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Ana Carreras Mascaro, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfhydryl groups in cysteines were alkylated with 10 mM 2-chloroacetamide (Fluka, Honeywell Research Chemicals) to form carbamidomethyl derivatives ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Amelia R. McCready-Vangi, et al.,
bioRxiv - Microbiology 2022
Quote:
... followed by the addition of 20 μL plasmin specific chromogenic substrate S-2251(H-D-Val-Leu-Lys-paranitroanilide, 2 mmol/L, Chromogenix) to each well ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Raphael Lutz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... in fresh human BM samples was performed according to the highly standardized flow cytometry approach developed and described by the Spanish Myeloma Collaborative Group using a commercially available EuroFlow 8-color 2-tube MM MRD Kit (Cytognos, Salamanca, Spain) [38] ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Pere Català, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from each cornea were seeded equally across 2 wells of a 24-well plate coated with fibronectin collagen (FNC) coating mix (Athena Enzyme Systems) in M5 stabilization media (human endothelial SFM (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...