-
No products found
because this supplier's products are not listed.
Jinge Gu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Hsp70 (StressMarq Biosciences Inc, SMC-100A/B), mouse anti-GAPDH (Proteintech ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
Capillaries were identified using rat anti-mouse CD31 antibodies (BMA Biomedicals, Cat#T-2001). Neutrophils were stained with a rat anti-Ly6G (GR1 ...
-
No products found
because this supplier's products are not listed.
Annette Choi, et al.,
bioRxiv - Microbiology 2023
Quote:
... we designed and ordered linear peptides that mimic the S1/S2 domain of the S glycoprotein for selected coronaviruses (Biomatik, Kitchener, Ontario). Information about the series of amino acid residues within the S1/S2 domain were obtained from NCBI ...
-
Cat# HY-P1349-500 μg,
500 μg, USD $190.0
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Cindy F. Yang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-somatostatin-14 antibody (Peninsula Laboratories, Cat# T-4103.0050, RRID: AB_518614) was raised in rabbit against the first 14 aa of the synthetic peptide SST ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
No products found
because this supplier's products are not listed.
Rekha Dhanwani, et al.,
bioRxiv - Immunology 2021
Quote:
The IgG antibodies of the subjects for both cohorts were measured using Cytomegalovirus IgG Elisa kit from Genway Biotech Inc ...
-
Cat# F107,
USD $169.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
Cytomegalovirus Glycoprotein B Antibody is a Mouse monoclonal antibody for infectious agents and...
Cat# abx021639-1MG,
1 mg USD $3407.5
Ask
Bálint Kiss, et al.,
bioRxiv - Biophysics 2020
Quote:
... 100 μl of 10 μg/ml SARS-CoV-2 Spike Glycoprotein Antibody (#abx376478, Abbexa Ltd, Cambridge, UK) was then added ...
-
No products found
because this supplier's products are not listed.
Srinu Tumpara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... allophycocyanin (APC)-conjugated mouse monoclonal anti-CD16 antibody (clone 3G8, Immunotools, Friesoythe, Germany), or BV-480 conjugated anti-CD56 mouse monoclonal antibody (Clone NCAM16.2 ...
-
Recombinant human monoclonal antibody expressed in CHO binding to human cytomegalovirus...
Cat# TAB-894,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Rania Akkawi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by incubation with secondary anti-mouse immunoglobulin antibody for 30 min (Nichirei Biosciences). The reaction was then performed using a DAB peroxidase kit (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
WB,IF,IP,IHC,FC,ELISA
Cat# A5712, SKU# A5712-20ul,
20ul, $47.00
Ask
Hongcheng Tang, Jiafeng Zhu, Shuyan Wu, Hua Niu,
bioRxiv - Microbiology 2022
Quote:
... The eluates were further purified with magnetic beads conjugated with mouse anti-FLAG antibody (Bimake, Shanghai, China) (15 μL/dish) ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... samples were incubated with primary antibody solutions diluted in blocking buffer including mouse anti-5-mC (1:2000; Epigentek) and rabbit anti-PV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Brian G. Pierce, et al.,
bioRxiv - Microbiology 2020
Quote:
The interaction of recombinant sE2 glycoproteins with CD81 and HMAbs in was measured using an Octet RED96 instrument and Ni2+-NTA biosensors (Pall ForteBio). The biosensors were loaded with 5 μg/mL of purified His6-tagged wild-type or mutant sE2 for 600 sec ...
-
No products found
because this supplier's products are not listed.
Lisa Dettinger, et al.,
bioRxiv - Microbiology 2021
Quote:
... Complete rabies virus nucleoprotein and glycoprotein gene sequences were generated from rabies virus RNA extracted using Direct-zol RNA MiniPrep kit (R2052 Zymo, Irvine, CA, USA). Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA ...
-
No products found
because this supplier's products are not listed.
Arjun Kalvala, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and anti-CD81 antibodies (System Biosciences, CA).
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Wener Li, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... cells were incubated with 1 mg/ml collagenase B (Worthington Biochemical) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Pilar X. Altman, et al.,
bioRxiv - Immunology 2024
Quote:
... BLI assays to detect tyrosine sulfation by binding antibodies with anti-sulfotyrosine antibodies were performed using polypropylene black 384-well microplate (Greiner) at 30°C in octet buffer (0.05% Tween in PBS) ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... anti-platelet glycoprotein (GP) IIb/IIIa (Sheep monoclonal, Affinity Biologicals Inc., Ancaster, Canada), glycophorin A (Dako/Agilent) ...
-
No products found
because this supplier's products are not listed.
Christopher R. Brown, James D. Foster,
bioRxiv - Neuroscience 2024
Quote:
... anti-mouse NET-05 and anti-human NET17-1 antibodies were from Mab Technologies. N-ethylmaleimide (NEM) ...
-
No products found
because this supplier's products are not listed.
Fangfang Han, et al.,
bioRxiv - Genetics 2020
Quote:
... anti-GPR146 antibody (CUSABIO,CSB-PA006863), anti-ATP1A1 antibody (Abclonal ...
-
No products found
because this supplier's products are not listed.
Jingyu Diao, et al.,
bioRxiv - Microbiology 2020
Quote:
... The anti-OmpA (Antibody Research Corporation), anti-GroEL (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Iwona Wojcik, et al.,
bioRxiv - Immunology 2020
Quote:
... FcγRIII were immunoprecipitated from the neutrophil cell lysate using a mouse anti-CD16 monoclonal IgG2a antibody (Ref M9087, Clone CLB-FcR gran/1, 5D2, Sanquin, Amsterdam, The Netherlands). Prior to usage ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Zhixin Cyrillus Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Quantum Simply Cellular (QSC) anti-mouse beads (Bangs Laboratories Ltd.) with known binding capacities for mouse IgG were used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
The fluorescence imaging experiment of CD44 on the MβCD-treated fixed KG1a cells was conducted in a way similar to that on the fixed control KG1a cells by using a combination of the anti-CD44 antibody and the Alexa-Fluor-647-conjugated anti-mouse secondary antibody.22 The cells were injected into poly-L-ornithine-coated microfluidic chambers (ibidi GmbH, sticky-slide VI 0.4) using the syringe pump and incubated overnight at 4°C.
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Rafael E. Sanchez-Pupo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Granzyme B imaging was performed in an LSM 800 Confocal Microscope (Carl Zeiss) using a Plan-Apochromat LCI Plan-Neofluar 25x (0.8 Imm Korr Water DIC ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Anna Höving, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were again seeded in gelatin B-coated T-25 cell culture flasks (Sarstedt AG & Co.) in hCSC-medium ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).