-
No products found
because this supplier's products are not listed.
Jinge Gu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Hsp70 (StressMarq Biosciences Inc, SMC-100A/B), mouse anti-GAPDH (Proteintech ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
Capillaries were identified using rat anti-mouse CD31 antibodies (BMA Biomedicals, Cat#T-2001). Neutrophils were stained with a rat anti-Ly6G (GR1 ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... A primary mouse antibody α-C4c (Quidel) was diluted to 1:10,000 followed by a secondary goat α-mouse antibody conjugated to horseradish peroxidase (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Aubin Moutal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or VEGF-B (1nM, Cat#RPU44324, Biomatik) for 30 min before recording ...
-
No products found
because this supplier's products are not listed.
Cindy F. Yang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-somatostatin-14 antibody (Peninsula Laboratories, Cat# T-4103.0050, RRID: AB_518614) was raised in rabbit against the first 14 aa of the synthetic peptide SST ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
Cat# F107,
USD $169.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
M Niklas, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
No products found
because this supplier's products are not listed.
Eleonora Lomi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Four retrograde tracers were employed for a total of 29 injections: (i) cholera toxin subunit B (CTB; Polysciences Inc, Eppelheim, Germany), (ii ...
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Christopher R. Brown, James D. Foster,
bioRxiv - Neuroscience 2024
Quote:
... anti-mouse NET-05 and anti-human NET17-1 antibodies were from Mab Technologies. N-ethylmaleimide (NEM) ...
-
No products found
because this supplier's products are not listed.
Farhan Anwar, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile colonies on TCCFA were transferred to 25 µL of PCR-Lyse™ (Epicentre, Madison, WI, USA) solution ...
-
No products found
because this supplier's products are not listed.
Srinu Tumpara, et al.,
bioRxiv - Cell Biology 2020
Quote:
... allophycocyanin (APC)-conjugated mouse monoclonal anti-CD16 antibody (clone 3G8, Immunotools, Friesoythe, Germany), or BV-480 conjugated anti-CD56 mouse monoclonal antibody (Clone NCAM16.2 ...
-
Recombinant Mouse Antibody recognizes and binds to Clostridium difficile Toxin A.
Cat# MOB-0355MC,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... difficile strains was estimated by quantitative PCR on genomic DNA extracted using the NucleoSpin Microbial DNA kit (Macherey-Nagel). The total chromosome copy number was quantified based on the reference gene dnaF (CD1305 ...
-
No products found
because this supplier's products are not listed.
Rania Akkawi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by incubation with secondary anti-mouse immunoglobulin antibody for 30 min (Nichirei Biosciences). The reaction was then performed using a DAB peroxidase kit (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Lucy R. Frost, et al.,
bioRxiv - Microbiology 2023
Quote:
... difficile as described above were washed thrice with PBS to remove unadhered bacteria and fixed with 4% paraformaldehyde (PFA) (Alfa Aesar, USA) for 15 min at RT ...
-
WB,IF,IP,IHC,FC,ELISA
Cat# A5712, SKU# A5712-20ul,
20ul, $47.00
Ask
Hongcheng Tang, Jiafeng Zhu, Shuyan Wu, Hua Niu,
bioRxiv - Microbiology 2022
Quote:
... The eluates were further purified with magnetic beads conjugated with mouse anti-FLAG antibody (Bimake, Shanghai, China) (15 μL/dish) ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... samples were incubated with primary antibody solutions diluted in blocking buffer including mouse anti-5-mC (1:2000; Epigentek) and rabbit anti-PV (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jingyu Diao, et al.,
bioRxiv - Microbiology 2020
Quote:
... The anti-OmpA (Antibody Research Corporation), anti-GroEL (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Arjun Kalvala, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and anti-CD81 antibodies (System Biosciences, CA).
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Zhixin Cyrillus Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... Quantum Simply Cellular (QSC) anti-mouse beads (Bangs Laboratories Ltd.) with known binding capacities for mouse IgG were used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
The fluorescence imaging experiment of CD44 on the MβCD-treated fixed KG1a cells was conducted in a way similar to that on the fixed control KG1a cells by using a combination of the anti-CD44 antibody and the Alexa-Fluor-647-conjugated anti-mouse secondary antibody.22 The cells were injected into poly-L-ornithine-coated microfluidic chambers (ibidi GmbH, sticky-slide VI 0.4) using the syringe pump and incubated overnight at 4°C.
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Pilar X. Altman, et al.,
bioRxiv - Immunology 2024
Quote:
... BLI assays to detect tyrosine sulfation by binding antibodies with anti-sulfotyrosine antibodies were performed using polypropylene black 384-well microplate (Greiner) at 30°C in octet buffer (0.05% Tween in PBS) ...
-
No products found
because this supplier's products are not listed.
Rafael E. Sanchez-Pupo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Granzyme B imaging was performed in an LSM 800 Confocal Microscope (Carl Zeiss) using a Plan-Apochromat LCI Plan-Neofluar 25x (0.8 Imm Korr Water DIC ...
-
No products found
because this supplier's products are not listed.
Aurora Alvarez-Buylla, et al.,
bioRxiv - Physiology 2023
Quote:
... we used the Zymo RiboFree Total RNA Library Prep kit (R3003-B, Zymo Research, Irvine, CA) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Raissa R. Christoff, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the following primary antibodies were incubated overnight: mouse anti-SATB21:200 (GenWay 20-372-60065); rabbit anti-PH3 1:500 (Millipore 06-570) ...
-
No products found
because this supplier's products are not listed.
Iwona Wojcik, et al.,
bioRxiv - Immunology 2020
Quote:
... FcγRIII were immunoprecipitated from the neutrophil cell lysate using a mouse anti-CD16 monoclonal IgG2a antibody (Ref M9087, Clone CLB-FcR gran/1, 5D2, Sanquin, Amsterdam, The Netherlands). Prior to usage ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Deanna N. Edwards, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Ad-CMV-b-Gal (Vector Biolabs #1080) or Ad-CMV-Null (Vector Biolabs #1300 ...
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
Clostridium difficile Toxin B Antibody is a Mouse Monoclonal antibody. Clostridium difficile...
Cat# abx120036-1MG,
1 mg USD $1102.0
Ask
Isabel Brandão, et al.,
bioRxiv - Physiology 2023
Quote:
... the primary antibody was a rabbit polyclonal anti-PXDN antibody (Abbexa; Cambridge, UK; catalog # abx101906), purified by antigen-specific affinity chromatography ...
-
No products found
because this supplier's products are not listed.
Anna Höving, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were again seeded in gelatin B-coated T-25 cell culture flasks (Sarstedt AG & Co.) in hCSC-medium ...