-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Sung-Eun Choi, et al.,
bioRxiv - Pathology 2020
Quote:
... Total protein in the hydrolysed sample was also measured using the Total Protein Assay Kit (QuickZyme) and the relative amount of collagen per protein was analysed.
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Ayan Rajgarhia, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and protein extraction was carried out using a total protein extraction Kit (BioChain Institute, Inc. Hayward, CA). Protein concentration was evaluated using the Modified Lowry Protein Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Donna Ye, et al.,
bioRxiv - Microbiology 2019
Quote:
... Media supplemented with milk protein (Hardy Diagnostics) was made by first sterilizing 2x media stocks (TSB or R2B ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Liina Hannula, et al.,
bioRxiv - Microbiology 2022
Quote:
... RBD wt (aa 319-541 of the S protein) and S1 wt (aa 14-681 of the S protein) from Medix Biochemica; RBD single mutants K417N ...
-
No products found
because this supplier's products are not listed.
Jyoti Kundu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Pre-stained protein ladder was procured from Real Biotech Corporation ...
-
No products found
because this supplier's products are not listed.
Georg T. Wondrak, et al.,
bioRxiv - Microbiology 2021
Quote:
... RNA and protein analysis (BrandTech™ 759170, Fisher Scientific)] ...
-
No products found
because this supplier's products are not listed.
Kelly Snead, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Proteins were purified on the Phynexus MEA (Biotage, Uppsala, Sweden) at 4°C using 40µL bed volume (BV ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Probe DNA (mouse rDNA BAC clone RP23-225M6, Empire genomics) was mixed with Hybridization buffer (50% formamide ...
-
No products found
because this supplier's products are not listed.
Oh Sung Kwon, et al.,
bioRxiv - Cell Biology 2020
Quote:
... To repress protein synthesis 100 μg/ml of cycloheximide (TOKU-E) and 300 μM of puromycin (InVivoGen ...
-
No products found
because this supplier's products are not listed.
Basudev Ghoshal, et al.,
bioRxiv - Plant Biology 2020
Quote:
... PeBV subgenomic coat protein RNA promoter was synthesized from SGI-DNA with XhoI and SmaI restriction sites at the 5’ and 3 ‘ ends of the promoter sequence ...
-
No products found
because this supplier's products are not listed.
Gozde S. Demirer, et al.,
bioRxiv - Plant Biology 2022
Quote:
... DNA sequences for these protein coding regions were synthesized by Bionexus™ into a GATEWAY™ compatible vector pUC57 with point mutations made to convert a proline to a lysine in Solyc04g079980 (P243-> L ...
-
Cat# LVs-187,
1 vial, USD $528
Ask
Leander Rohr, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Proteins were transiently expressed using the AGL1 Agrobacterium tumefaciens strain (Lifeasible), as previously described (Hecker et al. ...
-
No products found
because this supplier's products are not listed.
Chen Jiang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Primary mouse keratinocytes were kept in culture medium (CnT-07; Cellntec) at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... Precipitated proteins were washed with 1 mL of 100% ethanol (Decon Laboratories Inc.) and incubated at 4°C for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Mayu Okada, et al.,
bioRxiv - Biophysics 2021
Quote:
... alignment of the protein was achieved using 20.0 mg/ml Pf1 phage (ASLA Biotech) in the NMR buffer ...
-
No products found
because this supplier's products are not listed.
Robert S. Kellar, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The proteins were dissolved into 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP, Oakwood Chemical, Estill, SC). The biomimetic WHDs were prepared using a ratio of 9:1 collagen to rhTE ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Hattori, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The neurons were cultured with or without SPARCL1 recombinant protein (80 nM, ATGP3891, NKMAX) from day 8 to day 14 as previously done (34) ...
-
No products found
because this supplier's products are not listed.
Jeremy Ariey-Bonnet, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The reagents (compound, protein, and fluorophore) were dispensed using an Echo550 acoustic dispenser (Labcyte): 100 nL of compound (from a 100% DMSO stock at 10 mM ...
-
No products found
because this supplier's products are not listed.
Stijn De Munter, et al.,
bioRxiv - Immunology 2023
Quote:
... 10 μM Rho-associated coiled–coil containing protein kinase (ROCK) inhibitor Y-27632 (Abmole) and 5 μM A83-01 (Tocris Bioscience)) ...
-
No products found
because this supplier's products are not listed.
Sarah G. Seman, et al.,
bioRxiv - Immunology 2024
Quote:
... These beads were either coated with purified protein derivative (PPD, AJ Vaccines, Copenhagen, Denmark) or left uncoated ...
-
No products found
because this supplier's products are not listed.
David S. Yang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Protein and incubation buffer were filtered with 0.22 μm Polyethersulfone (PES) (CELLTREAT Scientific Products, 229746) syringe filters ...
-
No products found
because this supplier's products are not listed.
Carmanah Hunter, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Polysialylated proteins were eluted by incubating twice with 200 μL 25 mg/mL colominic acid (Carbosynth) at room temperature for 1 – 2 h and collecting the supernatant ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Rubika Balendra, et al.,
bioRxiv - Neuroscience 2022
Quote:
Poly(PR) 20-mer dipeptide repeat protein with a C-terminal FLAG tag was purchased from CSBio and verified by mass spectrometry ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Kiall F. Suazo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... was then used to quantify protein yields and aliquots of 100 μg were subjected to click reaction with TAMRA-N3 (25 μM TAMRA-N3 (BroadPharm), 1 mM TCEP ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Joyeeta Chakraborty, et al.,
bioRxiv - Biochemistry 2024
Quote:
5 μL of protein was added on a glow discharged (one round of 15 mA current for 25 seconds using plasma cleaner, Quorum Technologies) carbon coated copper grid and incubated for 2 minutes before blotting out the protein ...
-
No products found
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
SL Plasil, A Seth, GE Homanics,
bioRxiv - Genetics 2020
Quote:
... Cas9 Nuclease V3 protein (IDT, #1081058) with a Bio-Rad Gene-Pulser Xcell in a 1mm-gap slide electrode (Protech International, #501P1-10) using square-wave pulses (five repeats of 3msec 25V pulses with 100msec interpulse intervals) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology, LVR-1046) to create the final lentiviral plasmid pLV-CMV-GCaMP6s-P2A-TACR1-T2A-hG15-PGK-Hyg ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Xuyong Chen, et al.,
bioRxiv - Immunology 2021
Quote:
... Antibodies were used for detecting the target methylation site (Table 2).Flow cytometry data were acquired on Novocyte (ACEA Biosciences) and were analyzed with FlowJo software (BD Biosciences).
-
No products found
because this supplier's products are not listed.
Tadayuki Komori, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Each cover glass was placed on a 35 μL spot of diluted primary antibody solution made on a sheet of parafilm (Bemis) so that the surface with cells present is facing the antibody solution45 ...
-
No products found
because this supplier's products are not listed.
Kourosh Kouhmareh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The labeled HA plus a combination of biotinylated monoclonal antibodies was mixed at a 1:16 ratio into phosphate buffered saline (PBS, 1X Caisson Labs PBL01-500ML) along with 0.1% Tween-20. ...