-
No products found
because this supplier's products are not listed.
Lu Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 2 weeks and subcutaneous injection of Angiotensin II (Abmole, USA) twice on day 15 ...
-
No products found
because this supplier's products are not listed.
Madanraj Appiya Santharam, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... or (iii) heavy (H: R10K8 = +18Da) isotopes (13C15N on both Arg and Lys: Cambridge isotope laboratories ...
-
This Type III Collagen product is isolated from human placenta and is purified using a...
Cat# 5021-10MG,
10 mg, USD $225.0
Ask
Antonios Chronopoulos, et al.,
bioRxiv - Cell Biology 2023
Quote:
... both NGA and flat control substrates were pre-coated with collagen type III (Advanced Biomatrix) at a concentration of 50 ug/mL in a 0.01M HCL solution for 1 hour at room temperature.
-
No products found
because this supplier's products are not listed.
Daria Antonova, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Ultrathin sections were prepared using the LKB-III ultramicrotome (LKB, Sweden) and applied to nickel grids (400 mesh, Ted Pella, United States) covered with a collodion film (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Lisa Scholtysek, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and STA3 (soluble starch synthase III; Cre06.g282000.t2.1) were cloned into the Escherichia coli expression vector pASK-IBA7 (IBA Lifesciences GmbH; www.iba-lifesciences.com/). Expression from this vector equips the target protein with an N-terminal Strep-tactin affinity tag (Strep-tag II) ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... KLK10 in mouse plasma was measured by using a mouse KLK10 ELISA kit (Antibodies-online, ABIN628061).
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Na Fei, et al.,
bioRxiv - Physiology 2023
Quote:
... Serum LBP level was measured by a Mouse Lipopolysaccharide Binding Protein ELISA Kit (HyCult Biotechnology, Uden, The Netherlands). All assays were performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Maxime De Rudder, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Factor V serum protein concentration was assessed by ELISA following manufacturer’s instructions (Mouse factor V ELISA kit orb409284, Biorbyt).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
Cat# RK289,
USD $225.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Daniel J. Rawle, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse serum was collected in Microvette 500 Z gel tubes (Sarstedt) with GzmA levels determined using a GzmA ELISA kit (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was intraperitoneally injected with 100 mg/kg BrdU (APExBIO, Houston, TX, USA) dissolved in saline ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Giovanny J. Martínez-Colón, et al.,
bioRxiv - Immunology 2021
Quote:
... n2019-nCoV (Biosearch technologies, KIT-NCOV-PP1-1000). For subgenomic N-gene quantification ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Silvia Acosta-Gutiérrez, et al.,
bioRxiv - Biochemistry 2022
Quote:
... using a KrosFlo® Research IIi Tangential Flow Filtration System (Spectrum Laboratories, Inc.). Additional Rho- ...
-
No products found
because this supplier's products are not listed.
Penghao Xu, et al.,
bioRxiv - Genomics 2023
Quote:
... iii) applying a new size selection method using HighPrep™ PCR Clean-up System (MagBio Genomics) to increase the yield of captured rNMPs.
-
No products found
because this supplier's products are not listed.
Kristin L Connor, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... iii) or mice fed a high fat (HF) diet (60% kcal as fat, D12492, Research Diets, New Brunswick, NJ, USA) ad libitum from 8 weeks before mating and throughout pregnancy (n=8) ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse sera (Complement Technology) was incubated with C1q (4.8 ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...
-
No products found
because this supplier's products are not listed.
Joanne Boldison, et al.,
bioRxiv - Immunology 2022
Quote:
... directly conjugated goat anti-mouse IgA (Cambridge Bioscience), rabbit anti-mouse TLR7 (Novus Biologicals) ...
-
No products found
because this supplier's products are not listed.
R Ragazzini, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... RBAP48 mouse mAb (GWB-C12FDE) was purchased from GenWay Biotech ...
-
No products found
because this supplier's products are not listed.
Thomas Dal Maso, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mouse genotyping was performed with WONDER Taq Hot START (Euroclone) using the following primers ...
-
No products found
because this supplier's products are not listed.
J. Tabitha Hees, Angelika B. Harbauer,
bioRxiv - Neuroscience 2023
Quote:
Primary mouse cortical neurons were seeded in 6 well plates (Greiner) at a density of 2*106 per well and maintained in NB+B27+PSG as described above ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Cristóbal Cerda-Troncoso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and the Magic Red® kit (Immunochemistry Technologies, Davis, CA, USA), respectively ...