-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
Cat# G209,
USD $10.00/EA
Ask
Elizabeth B. Draganova, et al.,
bioRxiv - Biophysics 2023
Quote:
... mouse antibody to HSV-1 VP5 (diluted 1:500 (Biodesign International) mouse antibody to FLAG epitope (diluted 1:1000 ...
-
No products found
because this supplier's products are not listed.
E.E. Van Haaften, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the supernatants were consecutively incubated with antibody-conjugated MagPlex microspheres (1 h), biotinylated antibodies (1 h), and streptavidin-phycoerythrin (10 min, diluted in high performance ELISA (HPE) buffer (Sanquin)) ...
-
No products found
because this supplier's products are not listed.
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse GAPDH (5G4MaB6C5, HyTest; 1:20.000 WB), Alexa Fluor 488 Phalloidin (Invitrrogen ...
-
No products found
because this supplier's products are not listed.
Weronika Czaban, Jim Rasmussen,
bioRxiv - Plant Biology 2019
Quote:
... ground plant material was extracted in a 1-ml extraction mixture of chloroform, methanol and water (1:3:1, v:v:v) in Sarstedts Eppendorf tubes (Sarstedt AG & Co, Nümbrecht, Germany). One metal bead (a 3-mm tungsten carbide bead ...
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
LC Laboratories' Product Number P-9099 - PI-103, Free Base (PI Kinase alpha Inhibitor 1;...
Cat# P-9099, SKU# P-9099_50mg,
50 mg, $199.00
Ask
Akihiko Sakashita, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× penicillin/streptomycin and 0.055 mM β-mercaptoethanol in DMEM high glucose (4.5 g l-1)) containing 2i (1 µM PD0325901, LC Laboratories; and 3 µM CHIR99021, LC Laboratories) and LIF (1,300 U ml-1 ...
-
No products found
because this supplier's products are not listed.
Jessica B. Sarthi, et al.,
bioRxiv - Physiology 2023
Quote:
... Mice were anesthetized with oxygen-delivered isoflurane (1-3%) at 1 L/min via a vaporizer (Braintree Scientific, Inc, Braintree, Mass). Mouse temperature was monitored by rectal probe and maintained at 37°C through automated warming using a controlled warming pad (ATCC 2000 ...
-
No products found
because this supplier's products are not listed.
Elsa Obergfell, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and in the presence of either 3 mM pBZR1169-175 or 3 mM pBKI1265-272 (Table 1) developed in Morpheus (Molecular Dimensions) condition G8 (with a final precipitant stock concentration of 50% [v/v] ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Kyung-Seok Han, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Patch pipettes of 1-3 MΩ resistance pulled from borosilicate capillary glass (Sutter Instrument, Novato, CA) with a Sutter P-97 horizontal puller ...
-
WB,ELISA
Cat# A5072, SKU# A5072-100ul,
100ul, $157.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
S. Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... containing 0.1% Triton X-100 and blocked 1 hour in 5% goat serum (Jackson Immuno Research, 005-000-121) 3% BSA (Pan Biotech, P06-1391100). Rabbit anti-phospho-ubiquitin ...
-
No products found
because this supplier's products are not listed.
Marija Mihailovich, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were then cultured in MEM1 (DMEM/F12 1:1 (Euroclone/Gibco) supplemented with NEAA 1% ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Sereen K. Nashif, et al.,
bioRxiv - Cell Biology 2023
Quote:
... media was collected and samples were tested for alpha HCG using ELISA assay (DRG International). DMSO treated samples were diluted (1:2 ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Kai Lu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were trained on an elevated T-maze 1 covered with Alpha-Dri (Shepherd Specialty Papers) bedding material ...
-
Cat# H1K237-5,
USD $1095.0/kit
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse monoclonal anti-gE antibody (Virusys), 1:500 mouse anti-MAP2 antibody (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Marieke G. Verhagen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... pCAG-Sema6a-GFP or pCAG-Sema6aΔcyt-GFP constructs in 1:3 PEI 1 mg/ml (Polyscience) in H2O ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Xiangzhou Meng, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Mouse α-BrdU (1:50, Becton Dickson) which recognizes IdU and rat α-BrdU (1:100, Accurate Chemical) which recognizes CldU in 5% BSA were then added onto slides ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Michael A. Mandell, et al.,
bioRxiv - Microbiology 2022
Quote:
... Samples were probed with the primary antibodies at 1:250 dilutions followed by FluoroNanogold anti-mouse Fab (1:250; Nanoprobes, Yaphank, NY) and silver enhancement (Nanoprobes HQ silver enhancement kit) ...
-
No products found
because this supplier's products are not listed.
Caylin G. Winchell, et al.,
bioRxiv - Microbiology 2020
Quote:
... before incubation in alpha-MEM + 10% StasisTM FBS (Gemini Bio-Products) + MitoTrackerTM Red CMXRos (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Simonas Juzenas, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The 3’-amino modified oligos (Supplementary Table S5) were activated by 1 mM NHS-methyltetrazine (Click Chemistry Tools) in 50% DMSO for 60 min at 21 °C ...
-
No products found
because this supplier's products are not listed.
Christopher W. Benson, et al.,
bioRxiv - Genomics 2023
Quote:
Fungal DNA was isolated from tissue grown in culture on potato dextrose agar (PDA; Alpha Biosciences Inc., Baltimore, MD) using the Fungi/Yeast Genomic DNA Isolation Kit (Norgen Biotek Corp., Ontario, Canada). High molecular weight DNA was prepared for sequencing using the SMRTbell Template Preparation kit (v.1.0) ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Nancy T Li, et al.,
bioRxiv - Bioengineering 2022
Quote:
Collagen hydrogel was prepared by mixing eight parts type I bovine collagen (PureCol 3 mg ml−1; Advanced BioMatrix) with 1 part 10x minimal essential medium (MEM ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Quantifoil R 0.6/1 Cu300 grid and incubated for 15-30 sec at 99% humidity in a Cryoplunge 3 (Gatan). The grid was blotted from both sides for 2.5-3 sec with Whatman grade 3 paper and plunged into liquid ethane at −175°C.
-
No products found
because this supplier's products are not listed.
Alexandros C. Kokotos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Control experiments included measurements of the binding of the RED-tris-NTA dye to His-DJ-1 and of a dye-labeled AptamerCy5 to AMP using a manufacturer kit (Monolith NT.115 Control Kit RED, NanoTemper).
-
No products found
because this supplier's products are not listed.
Guangai Xue, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and T107A) was co-transfected with a VSV-G expression vector at a ratio of 3:1 using Hilymax (Dojindo Molecular Technologies). The medium was replaced after overnight incubation and viral supernatants were collected at 48 h post-transfection ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Relber Aguiar Gonçales, et al.,
bioRxiv - Microbiology 2019
Quote:
... Total RNA (1 μg) was reversely transcribed using the NZYTech Reverse Transcriptase cDNA Synthesis kit (NZYTech, Portugal) according to the manufacturer’s instructions ...