-
No products found
because this supplier's products are not listed.
Logan D. Morton, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and O-(1H-6-Chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU) coupling reagent (99.9%, Chem-Impex International, Inc.), and a ten-fold excess of N-methylmorpholine (99% ...
-
No products found
because this supplier's products are not listed.
Dorothea Höpfner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ATP (Biosynth Carbosynth), ADPR (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Hannah E. Opalko, et al.,
bioRxiv - Cell Biology 2019
Quote:
... ATP-γS (Axxora BLG-B072-05) was added to each reaction at a final concentration of 50 μM ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... mouse anti-TH (Immunostar 22941) 1:300 ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Caijun Wu, et al.,
bioRxiv - Immunology 2022
Quote:
... Mouse Factor X total antigen was measured using kit from Molecular Innovations (Cat. No. MFXKT-TOT).
-
No products found
because this supplier's products are not listed.
Linh Nguyen, et al.,
bioRxiv - Biochemistry 2021
Quote:
Stocks of Glucosylceramide Synthase Inhibitor (GENZ-123346, Toronto Research Chemicals) in cell-culture grade dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Stephanie.B Telerman, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5mM Mg-ATP solution (Boston Biochem, B-20), 0.5 mM DTT ...
-
No products found
because this supplier's products are not listed.
Kei Saotome, et al.,
bioRxiv - Biochemistry 2022
Quote:
... A CM5 sensor chip (Cytiva) was prepared by EDC/NHS coupling of Strep-Tactin-XT (IBA Lifesciences). Running buffer was 8mM TRIS ...
-
No products found
because this supplier's products are not listed.
Junya Yokoyama, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 4 ng/mL human basic fibroblast growth factor (bFGF; Wako, Osaka, Japan) on mouse embryonic fibroblast cells (ReproCELL).
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
Human factor α-XIIa (Enzyme Research Laboratories Ltd) activity was measured at an enzyme concentration of 0.17 U/mL in 150 mM NaCl and 50 mM Tris-HCl (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Alan Shaw, et al.,
bioRxiv - Biophysics 2021
Quote:
... Anti-digoxigenin antibodies were coupled to 1 um polystyrene beads via NHS-EDC coupling: 50 ul of 5% (w/v) 1 um carboxylated polystyrene beads (Spherotech, USA) was buffer exchanged in to reaction buffer (MES-NaOH ...
-
No products found
because this supplier's products are not listed.
Igor Bychkov, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... each 6 week old mouse get 2.5 ×106 units of Cre recombinase adenovirus (Vector Biolabs, Malvern, PA), the 129S/Sv-KP mice develop lung disease similar to that of humans ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Margarida Beatriz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Mitochondrial movement videos were acquired on a Zeiss Cell Observer Spinning Disk System (Carl Zeiss Microscopy). For reference purposes ...
-
No products found
because this supplier's products are not listed.
Anja Kopp, et al.,
bioRxiv - Biochemistry 2023
Quote:
Screening of crystallization conditions for wild type GSDMD and GSDMDΔ184-194/Δ247-272 in complex with nanobodies VHHGSDMD-1 to VHHGSDMD-6 and the combination of VHHGSDMD-2 plus VHHGSDMD-6 was performed using commercial kits from Molecular Dimensions (Maumee, OH, USA) and Jena Bioscience (Jena ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stephen D. Glasgow, et al.,
bioRxiv - Neuroscience 2019
Quote:
Mouse brains were processed (FD Rapid GolgiStain Kit; FD Neurotechnologies) and cut into 100 μm sections with a cryostat ...
-
No products found
because this supplier's products are not listed.
Surya Chandra Rao Thumu, et al.,
bioRxiv - Neuroscience 2023
Quote:
6-OHDA (HelloBio, UK, #HB1889) injections in mice were performed as described earlier (Grealish et al. ...
-
No products found
because this supplier's products are not listed.
Ottilie von Loeffelholz, et al.,
bioRxiv - Biophysics 2020
Quote:
... 0.2 mM ATP) and 4 μl were applied to glow-discharged 1.2/1.3 holey gold grids (Quantifoil) before plunge freezing in liquid ethane using a Vitrobot (FEI/Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Natascia Marino, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and BeadBug 6 homogenizer (Benchmark Scientific) in a cold room at the following conditions ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Duško Lainšček, et al.,
bioRxiv - Immunology 2020
Quote:
... 6-8 kDa cutoff (Spectrum Laboratories, USA). Samples were purified using NiNTA resin (Goldbio ...
-
No products found
because this supplier's products are not listed.
Abril Gijsbers, et al.,
bioRxiv - Biochemistry 2021
Quote:
Samples were incubated with trypsin for different length of time at a molar ratio of 1:6 (enzyme:substrate) following the Proti-Ace™ Kit (Hampton Research) recommendation ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Yurika Matsui, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Resolving gels: 6-12% ProtoGel (National Diagnostics EC8901LTR), 0.375 M Tris-HCl (pH 8.8) ...
-
No products found
because this supplier's products are not listed.
Mouhamed Alsaqati, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ESGRO leukemia inhibitory factor (LIF) (Chemicon) at 37°C in an incubator (Galaxy 170R, New Brunswick, USA). The mECs media were changed daily and cells were passaged every other day using TrypLE (Gibco ...
-
No products found
because this supplier's products are not listed.
Aurelie de Rus Jacquet, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The number of CD63+ EVs collected in the EV-enriched fractions were estimated by ELISA (System Biosciences). The ELISA standards provided in the kit are calibrated by NTA to measure the number of exosomes and establish a standard curve based on exosome abundance ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Goat-anti-mouse IgG (Advansta) (1/10000 ...
-
No products found
because this supplier's products are not listed.
Pati Moloko Maindo, et al.,
bioRxiv - Microbiology 2019
Quote:
Serum samples were routinely screened for HBsAg using ELISA (Hepanostika® HBs, Biomérieux, France and Abbott GmbH & Co. KG, Wiesbaden, Germany), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuxuan Lin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mouse anti-Aub antibody (1:20) (Patil and Kai 2010) or mouse anti-mKate2 (Evrogen, 1:200) was added to the cleared lysate and incubated at 4°C for 2 h with rotation ...
-
No products found
because this supplier's products are not listed.
Jeffrey L Hansen, Barak A Cohen,
bioRxiv - Genomics 2021
Quote:
... or goat anti-mouse (Epicypher #13-0048) polyclonal secondary antibodies ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Alisa E. Shaw, et al.,
bioRxiv - Biochemistry 2024
Quote:
... or mouse anti-α-tubulin (ABM # G094) at 1:8000 for a loading control ...
-
No products found
because this supplier's products are not listed.
Manuel García-Jaramillo, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... The mass calibration was automatically performed every 6 injections using an APCI positive/negative calibration solution (AB SCIEX) via a calibration delivery system (CDS) ...
-
No products found
because this supplier's products are not listed.
Hélène Neyret-Kahn, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The ends of the DNA fragments were ligated to double stranded barcoded DNA adapters (NEXTflex ChIP-Seq Barcodes - 6, #514120, Bioo Scientific) using T4 DNA Ligase ...