-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma Induced Protein 10kDa (IP10) ELISA Kit (RD-IP10-Mu, Reddot biotech) were used in this study.
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Changjun Yang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Adropin levels in mouse plasma were quantified using an ELISA kit (Cat. No. EK-032-35, Phoenix Pharmaceuticals, Inc., Burlingame, CA) as recommended by the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Victoria L. Messerschmidt, et al.,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with Vasculife VEGF growth factor kit (LS-1020, Lifeline Cell Technologies) up to passage 7 in a 5% CO2 environment ...
-
12 well plate with tissue culture treated #1.5 glass-like polymer cover slip (0.175±0.010mm)....
Cat# P12-1.5P,
20/case, $221.00
Ask
Avishek Prasai, et al.,
bioRxiv - Cell Biology 2023
Quote:
MEF cells expressing GPR161-mCherry or mNG-ARL13B and LifeAct-TagRFP were cultured on glass bottom dish (CellVis) until confluent ...
-
Kit consists of 1-500mL SF-4Z0-500-S Serum-Free Medium, 1-10mL vial of Attachment Factor™ and...
Cat# SF-4Z0-500-S,
510.0 mL, $250.0
Ask
Ariana Umana, et al.,
bioRxiv - Microbiology 2019
Quote:
... cell attachment factor (Cell Systems) and a thin lining of collagen (5mg/ml_ ...
-
No products found
because this supplier's products are not listed.
Sharon Spizzichino, et al.,
bioRxiv - Biochemistry 2021
Quote:
... BCA kit (quantumMicro Protein, EMP015480, EuroClone).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Platelet-activating Factor was from Avanti polar Lipids, Alabaster ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Benedikt Graf von Armansperg, et al.,
bioRxiv - Microbiology 2020
Quote:
Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
No products found
because this supplier's products are not listed.
Kamran Bakhtiari, Joost C.M. Meijers,
bioRxiv - Biochemistry 2019
Quote:
... plasma-derived factor IX (Nonafact®, Sanquin, Amsterdam, the Netherlands), activated factor IX6 ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
AL Chenery, et al.,
bioRxiv - Immunology 2020
Quote:
... fusion proteins were generated of mouse IL-4 and IL-13 with the Fc portion of IgG1 (custom order with Absolute Antibody). Mice were injected intraperitoneally with either PBS ...
-
Cat# HY-P70408-50 μg,
50 μg, USD $360.0
Ask
Muhammad Jamal, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The protein signal in the membrane was detected by using an ultra-high sensitivity ECL kit (MedChemExpress, USA). Antibodies ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Flore Oudouhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... The production of proteins was assessed with monoclonal mouse anti-Helicobacter pylori CagA (HyTest Ltd.) and rabbit Cagα antiserum (Abcam) ...
-
No products found
because this supplier's products are not listed.
Christoph Gerdes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Micropipette tips were sharpened at an angle of 20-30° until the pipette tip had a syringe-like shape (Micropipette Beveler 48000; World Precision Instruments). Micropipettes were filled with 3 μl of plasmid solution/s (600 ng/μl) ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Nina M. Dräger, et al.,
bioRxiv - Neuroscience 2022
Quote:
The two donor plasmids for inducible expression of six codon-optimized transcription factors were constructed using the plasmid pUCM (GENEWIZ). Human iPSCs (WTC11) ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Kevin W. Bollinger, et al.,
bioRxiv - Microbiology 2024
Quote:
... and Ldt3 was raised against purified protein (ProSci). To analyze protein levels by Western immunoblotting ...
-
No products found
because this supplier's products are not listed.
Kyoko Chiba, et al.,
bioRxiv - Biophysics 2021
Quote:
The purified proteins were analyzed using BioSep SEC-s4000 (Phenomenex) particle size 5 μm ...
-
No products found
because this supplier's products are not listed.
Robert R. Bowers, et al.,
bioRxiv - Genetics 2021
Quote:
... coli kit (MS-CRED-KIT) was purchased from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).