-
Cat# ACT-IDMWD100,
USD $75.76/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Nikolaos Skartsis, et al.,
bioRxiv - Immunology 2021
Quote:
... CD28 superagonist (CD28SA) (5μg/mL; clone anti-CD28.1; Ancell, Stillwater, MN) were used to stimulate the T cells.
-
No products found
because this supplier's products are not listed.
Carole J Kuehl, et al.,
bioRxiv - Microbiology 2019
Quote:
... diluted in PBS with 0.5% BSA and 0.5% Triton X-100: anti-Shigella-FITC (1/1000; #0903, Virostat); anti-E-cadherin 1:100 (610181 ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% of the KH-103 in Captisol/DMSO was formulated in 20% Solutol (GLPBIO) in 0.9% sterile saline (Moltox) (w:v ...
-
No products found
because this supplier's products are not listed.
Steven C. Perry, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Oxylipin-treated platelets were stimulated with 0.25 µg/mL of collagen (Chrono-log), under stirring conditions (1100 rpm ...
-
No products found
because this supplier's products are not listed.
Preeti Sareen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Fly arenas were prepared by pouring agarose based foods in two-compartment petri-dishes (90-100 mm diameter) from Kord Valmark, EMS ...
-
No products found
because this supplier's products are not listed.
Kaamini M. Dhanabalan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 85-100 kDa and 190-240 kDa (85:15) with carboxylic acid end groups were purchased from Akina (AP041, AP089, AP036) (West Lafayette ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
J. Ibáñez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... bipolar EMG from the TA was recorded with two surface Ag-AgCl electrodes 2 cm apart (WhiteSensor 40713, Ambu). The ground electrode was placed on the right ankle ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Thomas H Mahood, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 100 mM Tris) to 800 μL before loading onto 30 kDa molecular weight cut off filters (Amicron Ultra 0.5; Milipore; Burlington, MA). Once samples were loaded (10,000 xg ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Elizabeth Ellis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Groups of flies — containing between 60 and 100 individuals — were introduced in a T-maze training apparatus (CelExplorer Labs Co., TMK-501) that was attached to a flowmeter that kept a constant stream of 0.7L/min (Dwyer Instruments ...
-
No products found
because this supplier's products are not listed.
Eduardo Seclen, et al.,
bioRxiv - Bioengineering 2024
Quote:
CD34+ HSPCs were transfected 48 hours after thawing and expansion by combining 5 μg of each AAVS1 TALEN mRNA or 10 μg of each CD11b TALEN mRNA with 1e6 HSPC in 100 μL BTXpress Solution (BTX Technologies, Hawthorne, NY, USA) and electroporating using the PulseAgile (Cellectis, Paris, France). One μg of Via-Enh01 mRNA and 4 μg of HDR-Enh01 mRNA were also included in the electroporation mix because Via-Enh0139 protein inhibits cell apoptosis and because HDR-Enh0140 increases homologous recombination by inhibiting the non-homologous-end-joining pathway ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Dorota Kawa, et al.,
bioRxiv - Plant Biology 2022
Quote:
... very gently dried with a paper towel and weighed in 25 mL pycnometers (Eisco Labs) were filled with water and weighted ...
-
No products found
because this supplier's products are not listed.
Thomas F. Martinez, et al.,
bioRxiv - Genomics 2019
Quote:
... Fluorescein-labeled reference peptide KVFPC(FITC)ALINK was synthesized by covalently coupling of fluorescein to the cysteine residue with 5-(iodoacetamido)fluorescein (Marker Gene Technologies, M0638) for use in the HLA-binding assay ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Soon-Gook Hong, et al.,
bioRxiv - Cell Biology 2023
Quote:
... modified with non-permeable tubing containing 13 mL of conditioned MCDB-131 (VEC Technologies #MCDB-131 WOFBS) with 10% FBS (Omega USDA certified FBS #FB-11 ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... or 300 ng/ml NP-BSA conjugated to digoxigenin following supplier recommendations (ANP technologies, 90-1023-1KT) for 90 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Jonathan Hus, et al.,
bioRxiv - Microbiology 2023
Quote:
... KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB) medium (Aldon Corporation Rochester, NY). These were grown overnight to saturation in a 37°C incubator and shaken vigorously at 250 cycles per minute on a rotary shaker ...
-
No products found
because this supplier's products are not listed.
A. Rahman, et al.,
bioRxiv - Immunology 2019
Quote:
... Lysates (containing protein at 6mg/mL) from four donors were pooled prior to Kinex antibody microarray analysis (Kinexus Bioinformatics) (H ...
-
No products found
because this supplier's products are not listed.
Elvira Mennillo, et al.,
bioRxiv - Immunology 2024
Quote:
... the antibodies were resuspended at a concentration of 0.2 mg/mL with Antibody Stabilizer (Boca Scientific, Dedham, Ma, USA) and stored at 4°C ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Madhur Kalyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... tb (0.1ml) were inoculated with 1:1 diluted blood (0.9 ml) in 7ml endotoxin free Sterilin Bijou tubes (Dynalab corporation, USA) and cultured for 4 days at 37ºC with slow shaking at 80 rpm.
-
No products found
because this supplier's products are not listed.
Max Z. Levine, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... the remaining pellet was transferred to a cold 50 mL Falcon tube using a sterile spatula (SmartSpatula□, LevGo, Inc., Berkeley, CA) while kept on ice ...
-
No products found
because this supplier's products are not listed.
Matthew Teryek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Screened microcapsules were transferred back to bioreactors and resuspended in 60 mL dissociation solution that consisted of Cell Recovery Solution (TheWell Biosciences), 0.1% w/v L-Cysteine (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Cecilie Knudsen, et al.,
bioRxiv - Immunology 2022
Quote:
... The antibodies were gold-conjugated using 40 nm gold particles at 15 OD/mL from a Naked Gold Conjugation Kit (BioPorto Diagnostics, NGIB18) according to the manufacturer’s protocols ...
-
Cat# ACM40809414-2,
Inquire
No citation found on bioRxiv
-
Cat# CDC10-0517,
1 kg, Inquire for price
No citation found on bioRxiv
-
Carbohydrate
Cat# GMS0100S,
Inquiry
No citation found on bioRxiv