-
No products found
because this supplier's products are not listed.
Bingxin Wang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... with or without a-X-Gal (GoldBio, 107021-38-5). See Table S1 for information about the primers.
-
No products found
because this supplier's products are not listed.
Tian Huang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50 mg Macerozyme R-10 (RPI, M22010), 50 mg Cellulose RS (RPI ...
-
No products found
because this supplier's products are not listed.
Monika Wimmer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... serum-free CnT-Prime Epithelial Culture Medium (CELLnTEC) at 37°C / 5% CO2 in a humidified incubator ...
-
No products found
because this supplier's products are not listed.
Liangdao Li, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... ESCs were cultured and maintained without feeders in N2B27 2i medium: 1μM PD0325901 (Reprocell; 04-0006-02), 3μM CHIR99021 (Reprocell ...
-
No products found
because this supplier's products are not listed.
Patrick J. Ferrara, et al.,
bioRxiv - Physiology 2019
Quote:
... Serum insulin was quantified using an insulin mouse serum kit (CisBio, 62IN3PEF) using Fluorescence Resonance Energy Transfer on a plate reader (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2022
Quote:
... Hepatocyte cultures were maintained with daily media change with customized InVitroGro HI medium without dexamethasone (BioIVT, NY, USA) supplemented with 5% human serum (Interstate Blood Bank) ...
-
No products found
because this supplier's products are not listed.
Benjamin E. Peterson, et al.,
bioRxiv - Bioengineering 2023
Quote:
... MicroVue Serum PYD (Quidel Crop., Kit #8019) and MicroVue DPD (Quidel Corp. ...
-
No products found
because this supplier's products are not listed.
Pierre Jacob, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The selenomethionine (SeMet) incorporated form of 7K(R)/E was produced using SelenoMetTM medium from Molecular Dimensions and 0.1 mM isopropyl-1-thio-D-galactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Dharma Pally, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the medium was replaced with DMEM without FBS for 1 hour before the plasmids pCDH-GAL-9-T2A-Puro (System Biosciences, CD527A-1) or pLKO ...
-
No products found
because this supplier's products are not listed.
Andres R. Henriquez, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Serum free fatty acids were measured using kits from Cell Biolabs, Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Rongjia Zhang, Yuhuan Liu,
bioRxiv - Developmental Biology 2021
Quote:
Adult female Lewis rats were stimulated to undergo superovulation through intraperitoneal injection of 15 IU pregnant mare serum gonadotropin (RP17827210000, BioVendor R & D); 48 h later ...
-
No products found
because this supplier's products are not listed.
Zhongzhen Liu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Serum/Plasma Circulating DNA Kit (TIANGEN, Cat. No.: DP339, TG for short), or from 1 mL plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN ...
-
No products found
because this supplier's products are not listed.
Michael Philippi, et al.,
bioRxiv - Biophysics 2022
Quote:
... with and without an additional 1.6x magnification (IX3-CAS, Olympus). Differential interference contrast (DIC ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kathryn G. Powers, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Serum renin levels were determined using an ELISA kit (ELM-Renin1-1, RayBiotech).
-
No products found
because this supplier's products are not listed.
Mariana Di Luca, et al.,
bioRxiv - Cell Biology 2021
Quote:
... while negative control was incubated with mouse IgG and input DNA without antibody using the CHIP—IT Express HT Kit from Active Motif (Cat no: 53018) according to the manufacturer’s instructions [Supplementary Table III] ...
-
No products found
because this supplier's products are not listed.
Sohei Ito, et al.,
bioRxiv - Pathology 2023
Quote:
Movat’s pentachrome staining was performed using Movat’s Pentachrome method for Connective Tissue kits (k042, Poly Scientific R×D) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jannell V. Bazurto, et al.,
bioRxiv - Microbiology 2020
Quote:
... and grown without lids at 37 °C in Synergy H1 plate readers (BioTek) with double-orbital shaking at 425 rpm and a 3 mm orbit and readings taken every 15 minutes (OD600 with 100 ms delay and 8 measurements per data point) ...
-
No products found
because this supplier's products are not listed.
Shivneet K. Gill, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Dilutions of human serum (Human Serum age 4-6, Innovative Research) were performed in TBSM ...
-
No products found
because this supplier's products are not listed.
Yogesh Singh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... non-specific binding was blocked for 40 min by treating sections with 5% normal serum of the secondary antibody host animal (goat serum: S-1000, Vector; rabbit serum: S-5000, Vector; donkey serum: 017-000-001, Dianova) diluted in TBS and supplemented with 0.3% Triton X-100 to permeabilize cell membranes ...
-
No products found
because this supplier's products are not listed.
Pablo Castro-Córdova, et al.,
bioRxiv - Microbiology 2020
Quote:
... difficile spores preincubated 1h at 37 °C with FBS, mouse serum (Pacific Immunology, USA), rat serum (Pacific Immunology, USA), rabbit serum (Pacific Immunology, USA) and NHS (Complement Technology USA) as was described above ...
-
No products found
because this supplier's products are not listed.
Feng Long, et al.,
bioRxiv - Genomics 2020
Quote:
... HEK293 cells stably transfected with or without wild SMOC2 -MYC were incubated in serum-free medium with MG132 (A2585, ApexBio Technology) at increasing doses (10μM ...
-
For safe collection, transport, and preservation of virus samples collected from...
Cat# G631,
100 Kits/Package, please contact supplier for pricing.
Ask
Zhihong Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the RNA extraction was probed with or without RNase R (Applied Biological Materials Inc., Vancouver, Canada) at 37□ for 10 min ...
-
No products found
because this supplier's products are not listed.
Maëlle Duperray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Minimal YNB medium contained 1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex) and 5 g/L ammonium sulphate ...
-
No products found
because this supplier's products are not listed.
Matúš Vojtek, Ian Chambers,
bioRxiv - Developmental Biology 2021
Quote:
... ESCs cultured in serum/LIF medium were adapted to serum-free N2B27 medium supplemented with 3 µM CHIR99021 (Cambridge Bioscience, cat. 1677-5), 0.4 µM PD0325901 (STEMCELL Technologies ...
-
No products found
because this supplier's products are not listed.
Lorenz Thurner, et al.,
bioRxiv - Immunology 2021
Quote:
... 11 patients with COVID-19 with PGRN-Abs and 8 patients without COVID-19 and without PGRN-Abs treated on ICU with a commercially available ELISA kit (AdipoGen, Incheon, South Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ciara Lynch, et al.,
bioRxiv - Microbiology 2023
Quote:
... Total glucans production was evaluated by a specific enzymatic kit (K-YBGL, Megazyme(R), Ireland ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
IL-6 levels in serum from patients and healthy controls were measured in freshly thawed serum using human IL-6 ELISA development kit (Mabtech), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rekha S. Varrier, Emily S. Finn,
bioRxiv - Neuroscience 2022
Quote:
... animations were balanced within and between runs (run 1: 2M,3R; sequence M-R-R-M-R; run 2: 3M, 2R ...
-
No products found
because this supplier's products are not listed.
Gulam Altab, et al.,
bioRxiv - Genomics 2024
Quote:
... R: CCAGGAACTCATACCCACGCTC (Origene, USA). Primers were obtained from previous literature or previously validated in our lab ...
-
No products found
because this supplier's products are not listed.
Michael Bouyer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... another negative control was added (EDC30 film without BMP-2), and bone autograft (n=4 ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS; Equitech-Bio), 100 U/mL penicillin ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
... we tested four kits including RPA (recombinase polymerase amplification) with ExoIII (TwistAmp® exo) or without ExoIII (TwistAmp® Basic) (Abbott, Illinois, US), MIRA (Multienzyme Isothermal Rapid Amplification ...
-
No products found
because this supplier's products are not listed.
Jennifer L. Reedy, et al.,
bioRxiv - Immunology 2023
Quote:
... For the R&D Duoset kits the ELISA were read using an i3X Spectrophotometer (Molecular Devices, LLC). For the LegendPlex assays ...
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Type 23F serum (Statens Serum Institut, 16913) antibody (1:200 in 0.5% FBS-PBS ...
-
No products found
because this supplier's products are not listed.
Charles M Manyelo, et al.,
bioRxiv - Immunology 2019
Quote:
Serum cathelicidin LL-37 levels were evaluated using an ELISA kit purchased from Elabscience Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Jiandong Zhang, et al.,
bioRxiv - Pathology 2022
Quote:
... Detection of serum HMGB1 was performed using a commercially available kit (Novus Biologicals, Centennial CO).
-
No products found
because this supplier's products are not listed.
Reetika Chaurasia, et al.,
bioRxiv - Microbiology 2020
Quote:
... were cultured in liquid EMJH medium to a cell density of ∼2 × 108 cells/mL supplemented with 120 mM NaCl and 10% rat serum (Rockland Immunochemicals, USA) to simulate the in vivo host environment and to induce virulence gene expression (59) ...
-
No products found
because this supplier's products are not listed.
Scott Hotaling, et al.,
bioRxiv - Genomics 2022
Quote:
... long-read PacBio (non-HiFi PacBio long-reads with or without short reads), or HiFi (any assembly where HiFi long-reads were used) ...
-
No products found
because this supplier's products are not listed.
Ernest Aw, et al.,
bioRxiv - Immunology 2023
Quote:
Serum samples were assayed on the VeriPlex Mouse Cytokine 9-Plex ELISA Kit (PBL Assay Science) by contract service from the company (PBL Assay Science).
-
No products found
because this supplier's products are not listed.
Gianluca Amadei, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plus 50% rat serum (rat whole embryo culture serum, Charles River) and 25% human chord serum obtained from the Cambridge Blood Biobank ...
-
No products found
because this supplier's products are not listed.
Ana Elena Pérez-Cobas, et al.,
bioRxiv - Microbiology 2019
Quote:
... pneumophila in the samples was detected by diagnostic PCR using primers and probes of the R-DiaLegTM kit (Diagenode, Belgium). The PCRs were prepared in a final volume of 20 μL by adding the Master Mix 5X (TaqMan Probe LC2.0 ...
-
No products found
because this supplier's products are not listed.
Simone C. Kleinendorst, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Serum HMGB1 levels were determined using the HMGB1 express ELISA kit according to manufacturer’s instructions (Tecan, 30164033).
-
No products found
because this supplier's products are not listed.
Isabel G. Azcárate, et al.,
bioRxiv - Microbiology 2019
Quote:
... Human reference serum from Bethyl Laboratories was used to generate a logistic four-parameter sigmoidal standard curve.
-
No products found
because this supplier's products are not listed.
Kara J.M. Taylor, et al.,
bioRxiv - Microbiology 2020
Quote:
... Levels of reovirus antibodies in serum were measured by ELISA using IDEXX REO Ab Test kit (IDEXX, Westbrook, Maine, USA). Antibodies against the Newcastle disease virus (NDV) ...
-
No products found
because this supplier's products are not listed.
Soha J. Chhaya, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Pooled ipsilesional C7 and C8 DRGs of each animal were homogenized in 1ml RNA-Solv Reagent (EZNA Total RNA kit, Omega Bio-Tek, R-6834, Norcross, GA) with 20 ul 2-mercaptoethanol per 1 ml reagent ...
-
No products found
because this supplier's products are not listed.
Oana Chever, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BSA (0.5 %, Bovine serum albumin, Amresco, USA) diluted in PBS ...
-
No products found
because this supplier's products are not listed.
Maria A. Toma, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 ug of total RNA from cultured keratinocytes or fibroblasts was treated without (control) or with 10 units of RNase R in 10X RNase R reaction buffer (LGC Biosearch Technologies, Hoddesdon, UK). Treatment was conducted at 37°C for 12 minutes ...
-
No products found
because this supplier's products are not listed.
Nilsa La Cunza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cells were plated at confluence (300,000 cells/sq.cm) in growth medium on serum-coated glass-bottom dishes (MatTek, Ashland, MA) and used for live imaging 48-72 h later ...
-
No products found
because this supplier's products are not listed.
André Folgado, Rita Abranches,
bioRxiv - Plant Biology 2021
Quote:
Cardosin B coding sequence (EMBL no. AJ237674) without the native signal peptide was synthesized by NZYTech (NZYTech, Portugal) with the addition of NcoI and SalI restriction sites at the 5’and 3’ends respectively ...