-
No products found
because this supplier's products are not listed.
Giovanni Scarinci, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... and a solution of 0.1 % formic acid 99:1 acetonitrile:water (Honeywell research chemicals) as phase B ...
-
No products found
because this supplier's products are not listed.
Melissa Bredow, et al.,
bioRxiv - Plant Biology 2020
Quote:
AtPep1(99) and elf18 (100) used for immune assays were synthesized by EZBiolab (USA). AtPep1-induced SGI and ROS burst assays were performed as previously described (101) ...
-
No products found
because this supplier's products are not listed.
Marc Ramos-Llorens, et al.,
bioRxiv - Biochemistry 2024
Quote:
... All FA substrates (>98–99% pure) used for the functional characterisation assays were obtained from Nu-Chek Prep, Inc ...
-
Peptide to GAD65 (78-97)
Cat# CCP2337,
1 mg USD $208.0, 5 mg USD $520.0, 10 mg USD $780.0
Ask
Ilaria Andreana, et al.,
bioRxiv - Pathology 2024
Quote:
... Alanine transaminase (CAK1002, Cohesion Biosciences) and Aspartate transaminase (CAK1004 ...
-
No products found
because this supplier's products are not listed.
Atul Rangadurai, et al.,
bioRxiv - Biophysics 2021
Quote:
... UltraMild DNA phosphoramidites (T, n-pac-C, n-tbpac-G, n-pac-A, n-fmoc-m1A) and Ultramild Cap A (Glen Research), and columns (1000 Å from Bioautomation ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Hossein Jashnsaz, Gregor Neuert,
bioRxiv - Systems Biology 2023
Quote:
... a 0.17 µm thick T-shape SecureSeal Adhesive spacer (Grace Bio-labs, 44560, 1 L 44040, R&D), a Microscope Cover Glass (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Psilocin (4-hydroxy-N,N-dimethyltryptamine, LGC Standards) was administered by intraperitoneal injection at a dose of 2 mg/kg ...
-
No products found
because this supplier's products are not listed.
Tural Aksel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Recombinant ubiquitin with N-terminal Histag (BPS Biosciences, P/N: 79293) and Alexa647-proteinA conjugate (Thermofisher ...
-
No products found
because this supplier's products are not listed.
David M. Anderson, et al.,
bioRxiv - Microbiology 2023
Quote:
... N-(acid-PEG10)-N-bis(PEG10-azide) (2803119-06-2, Broadpharm), β-Lactose-PEG3-azide (246855-74-3 ...
-
No products found
because this supplier's products are not listed.
Ryota Sato, et al.,
bioRxiv - Immunology 2023
Quote:
... Aspartate amino transferase (AST) and alanine aminotransferase (ALT) levels were measured using the Biochemical automatic analyzer JCA-BM6050 (JEOL Ltd., Tokyo, Japan) in ORIENTAL YEAST Co. ...
-
No products found
because this supplier's products are not listed.
Erika H. Dawson, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... n-tetracosane and n-hexatriacontane at 0.1 µg/mL concentration (both CDN Isotopes), both fully deuterated to enable spectral traceability and separation of internal standards from ant-derived substances ...
-
Recombinant Antigen
Cat# REC31701-100,
100µg USD $488.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... N (The Native Antigen Company, REC31812), SARS-CoV S (produced in house) ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Hirak Saxena, et al.,
bioRxiv - Microbiology 2023
Quote:
All strains were grown in 2YT media (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, BioShop Canada). NEB® Stable E ...
-
No products found
because this supplier's products are not listed.
Zibin Zhou, et al.,
bioRxiv - Biochemistry 2023
Quote:
... anti-pS/T (ECM Biosciences, PP2551, New Jersey, USA), anti-PKM2 (CST ...
-
No products found
because this supplier's products are not listed.
Marvin Reich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and cathepsin L (Abnova, KA0770) were performed according to the manufacturer’s instructions using samples with normalized protein concentrations ...
-
No products found
because this supplier's products are not listed.
Yudong Guan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A2F N-glycan standards were obtained from QA-Bio. Two different batches of EPOs (epoetin beta ...
-
No products found
because this supplier's products are not listed.
Pierre Santucci, et al.,
bioRxiv - Microbiology 2020
Quote:
... whereas wells containing 5 mg/L or 2.5 mg/L of RIF (LKT laboratories, R3220) and BDQ (MedChemExpress ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Geoffrey M.W. Cook, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... was acetylated with acetic acid N-hydroxysuccinimide ester (Apollo Scientific) as described64 and the product shown to be homogeneous by thin layer chromatography ...
-
No products found
Michael P. Vincent, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Fmoc-N-amido-dPEG24-amido-dPEG24-acid (Quanta Biodesign) were purchased for use in the synthesis of the PG6 ...
-
No products found
Alexander J. Ehrenberg, et al.,
bioRxiv - Pathology 2019
Quote:
... goat-anti-guinea pig IgG (H+L) – (R-05076, Advansta, or goat-anti-Rabbit IgG (H+L)-R-05072 ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were grown in 1 L of media in 1 L spinner flasks (Bellco, SKU: 1965-61010). 48 hours after spinfection with the genome-wide library ...
-
No products found
because this supplier's products are not listed.
Franziska Blaeschke, et al.,
bioRxiv - Immunology 2022
Quote:
... T cells were incubated with NY-ESO-1 specific dextramer (Immudex) for 12 min at RT (1:50 dilution) ...
-
No products found
because this supplier's products are not listed.
Yingli Gu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 0.1% Poly-L- Lysine (Cultrex® Poly-L-Lysine) was from Trevigen (Gaithersburg, MD; Cat# 3438-100-01). Mouse NGF was purified from submaxillary glands as described previously94 ...
-
No products found
because this supplier's products are not listed.
Trupti Shetty, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-methyl protoporphyrin (NMPP) was purchased from Frontier Scientific (Logan, Utah, USA) and prepared in DMSO ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... T cells were frozen in Bambanker Cell Freezing Media (Bulldog Bio Inc, BB01) and stored in liquid nitrogen until use ...
-
No products found
because this supplier's products are not listed.
Silvio D. Brugger, et al.,
bioRxiv - Microbiology 2020
Quote:
... The overnight culture was then inoculated at 1:25 into fresh BHI broth and grown for 24 hrs at 37°C prior to measuring the lactic acid concentration (mmol/L) using a D-lactic acid/L-lactic acid kit per the manufacturer’s instructions (Cat. no. 11112821035, R-Biopharm AG).
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Matthew S. Yorek, et al.,
bioRxiv - Microbiology 2019
Quote:
... HV or analytical column through a microcross assembly (IDEX, P/N UH-752). Peptides are desalted on the trap using 16μl mobile phase A for 4 min ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
You Wu, Tam L. Ngyuen, Carrie E. Perlman,
bioRxiv - Physiology 2020
Quote:
... apply a vascular clamp (S&T B1-V, Fine Science Tools, Foster City, CA) between the right middle and caudal lobes and separate the caudal lobe distal to the clamp ...
-
No products found
because this supplier's products are not listed.
Rajendra Karki, et al.,
bioRxiv - Immunology 2020
Quote:
... or 500 μg of neutralizing antibody against TNF-α (Leinco Technologies, Inc., T-703) plus 500 μg of neutralizing antibody against IFN-γ (Leinco Technologies ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and the L-lactate Assay Kit (Eton Biosciences, USA), respectively ...
-
No products found
because this supplier's products are not listed.
Heesun Kim, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... transferred to Poly-L-lysine coated slides (Labscientific, 7799) and mounted with 10 μl of SlowFade Diamond Antifade Mountant with DAPI (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Enrica Saponara, et al.,
bioRxiv - Physiology 2021
Quote:
... L-Type Triglycerol M (Wako Diagnostics, Enzyme Color R1 & R2), 96-well ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Catherine A. Cotter, et al.,
bioRxiv - Microbiology 2022
Quote:
... wells were washed three times with 250 μl PBS + 0.05% Tween-20 (PBS-T, Accurate Chemical). Plates were blocked for 2 h at room temperature with 200 μl PBS-T + 5% nonfat milk and subsequently washed three times with PBS-T prior to incubation with a series of eight 4-fold dilutions of mouse sera for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Melisa Lázaro, et al.,
bioRxiv - Microbiology 2020
Quote:
... This was confirmed by labeling N-terminally His6-tagged mL-GDH180 with Ni-NTA-Nanogold (Nanoprobes) and visualizing particles by negative staining electron microscopy ...
-
No products found
because this supplier's products are not listed.
Juliet Mwirigi, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cells were plated onto Poly-L-Lysine coated E-plates (ACEA Biosciences) in low serum medium (5% FBS ...
-
No products found
because this supplier's products are not listed.
M.R. Farrell, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Separate animals (n = 8) were trained to respond for 45 mg chow pellets (Bio-Serv, Ct # F0165) instead using the same procedures ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
K.G. Daniels, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... T cells were cryopreserved in RPMI1640 (UCSF cell culture core) with 20% human AB serum (Valley Biomedical, #HP1022HI) and 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Gadisti Aisha Mohamed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Slides were washed in TBS + 0.1% tween (TBS-T) and blocked in Antibody Diluent/Block (Akoya Biosciences, ARD1001EA) for 30 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Nirdosh Dadwal, et al.,
bioRxiv - Biochemistry 2021
Quote:
For cell surface expression on Jurkat T cells 0.2 × 106 cells were incubated with anti-CD18 (clone MEM-48, antibodies-online.de), anti-CD184 (CXCR4 ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with EM goat anti-mouse IgG (H&L) 10 nm gold conjugated (BBI solutions, EM.GMHL10) (7:100 ...
-
No products found
because this supplier's products are not listed.
Kimberly S. Collins, et al.,
bioRxiv - Systems Biology 2021
Quote:
... samples of background control and db mice (n = 5 per group) were prepared using the automated MicroLab STAR® system (Hamilton Company, Reno, NV). Metabolomic analysis was performed at Metabolon Inc ...