-
No products found
because this supplier's products are not listed.
Miwa Umebayashi, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Methyl beta cyclodextrin was purchased from CycloLab. Cholesterol-water soluble ...
-
Rabbit polyclonal antibody to Integrin beta 5
Cat# CPA1620,
200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0
Ask
Tiong Kit Tan, et al.,
bioRxiv - Immunology 2020
Quote:
... IgG-Alexa Fluor-647 mAb (Cohesion Biosciences, Generon,), IgA-FITC polyclonal Ab (BioRad Antibodies ...
-
No products found
because this supplier's products are not listed.
Eline Berends, et al.,
bioRxiv - Neuroscience 2023
Quote:
Within the PIMSoft software (Version 1.11.0.22471 Beta, PeriMed, Järfälla, Sweden) regions of interest were placed on the barrel cortex on both the left and right hemisphere (10mm2) ...
-
No products found
because this supplier's products are not listed.
S Momsen Reincke, et al.,
bioRxiv - Immunology 2021
Quote:
... mixed 1:1 with non VOC HRP-RBD or Beta HRP-RBD (Medac, Wedel, Germany) solution and incubated at 37°C for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Xiaowei Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Recombinant human insulin (M9194) was purchased from AbMole (Houston, USA). The ARF1 inhibitor Golgicide A (HY-100540 ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Jennifer Doucet, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Amino acid sequences were retrieved from EnsemblPlants (Actinidia chinensis, Beta vulgaris, Arabidopsis lyrata, Brassica oleracea, Corchorus capsularis, Cucumis sativus, Daucus carota, Medicago truncatula ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
María Belén Palma, et al.,
bioRxiv - Cancer Biology 2021
Quote:
WB analysis was performed to assess the expression of the HLA-G protein in RCC7/HLA-G1 after transfection of the CRISPR/Cas9 system by using the 4H84 mAb (Exbio) at a 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Yongle Chen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were pretreated by overnight incubation at 37°C with a 10 µL mixture of 5 ng/µL dodecyl-beta-D-maltoside (DDM, J&K Scientific, China) and 1 ng/µL trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Alejandro M. Gomez, et al.,
bioRxiv - Immunology 2023
Quote:
... was induced by retro-orbital injection of a cocktail of 5 monoclonal antibodies (mAbs) against mouse collagen type II (anti-CII cocktail, Chondrex Inc), followed by intraperitoneal injection of lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Menglin Shi, Lei Zhao, Yong Wang,
bioRxiv - Plant Biology 2021
Quote:
The recombinant HPRs was purified with HIS-Select nickel affinity gel filler (CoWin Biosciences, Beijing, China). Briefly ...
-
No products found
because this supplier's products are not listed.
Manuel V. Borca, et al.,
bioRxiv - Microbiology 2019
Quote:
... Recombinant transfer vector p72mCheryΔI177L was obtained by DNA synthesis (Epoch Life Sciences Missouri City, TX, USA).
-
No products found
because this supplier's products are not listed.
Young Sun Hwang, M. Andrés Blanco, Kotaro Sasaki,
bioRxiv - Developmental Biology 2022
Quote:
... hiPSCs were cultured on plates coated with recombinant laminin-511 E8 (iMatrix-511 Silk, Nacalai USA) and maintained under feeder-free conditions in StemFit® Basic04 medium (Ajinomoto ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
Cat# MRNA14-20,
20µg, USD $168.00/20µg
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Rida Rehman, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-HELLS (1:100, Antibodies.com), Rat anti-Vitronectin (1:100 ...
-
No products found
because this supplier's products are not listed.
Daniel Kirchmeier, et al.,
bioRxiv - Immunology 2023
Quote:
... rabbit α-CD3 (SP7, Diagnostic Biosystem), rabbit α–human CD103 (EPR4166(2) ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology, Inc., (Texas A&M) or R&D Systems (UCSD) ...
-
No products found
because this supplier's products are not listed.
Georgi K. Marinov, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 µL of each synthetic sgRNA were incubated at room temperature with 1 µL of recombinant purified dCas9 (MCLab dCAS9B-200) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Haley E. Mudrick, et al.,
bioRxiv - Immunology 2021
Quote:
... and Rabbit Anti-Hamster IgA (Brookwood Biomedical). For mouse samples ...
-
No products found
because this supplier's products are not listed.
Stefanie Lübke, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... rabbit anti-β -Gal 1:5000 (Biotrend), rabbit anti-GFP 1:500 (abcam) ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Gonzalo Sanchez, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IFT88 (F41236 NSJ Bioreagents, host: rabbit, 1:200), SSTR3 (E-AB-1607 Elabscience ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
Beta defensin 3 is an antimicrobial peptide produced by Equus caballus (Horse). It has...
Cat# BAT-013027,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... Bacteria were stained with rabbit anti-capsule (Type 4 (Statens Serum Institut, 16747) and Type 23F serum (Statens Serum Institut ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...