-
No products found
because this supplier's products are not listed.
Jin Wang, et al.,
bioRxiv - Systems Biology 2019
Quote:
... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
No products found
because this supplier's products are not listed.
Yukari Nagatoshi, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Samples of 1 to 2 mg were weighed using a microbalance (BM-22; A&D Company Limited, Japan) and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400 ...
-
No products found
because this supplier's products are not listed.
Thea Brennan-Krohn, et al.,
bioRxiv - Microbiology 2021
Quote:
... Caspofungin (CAS) was obtained from Carbosynth (Oakbrook Terrace, IL). Amphotericin B (AMB ...
-
No products found
because this supplier's products are not listed.
Joshua B. R. White, et al.,
bioRxiv - Microbiology 2022
Quote:
... The cells were lysed with a single pass at 22 kpsi through a cell disruptor (0.75 kW; Constant Systems). Membranes were isolated by ultracentrifugation for 45 min at 42,000 rpm (45 Ti rotor ...
-
No products found
because this supplier's products are not listed.
Phuc Leo H. Vo, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 μg of high molecular weight gDNA from each sample (n=20–22 per pool) was sheared using a g-TUBE to ~15 kb (Covaris). Sheared gDNA samples were then used as input for SMRTbell preparation using the Express Template Preparation Kit 2.0 ...
-
No products found
because this supplier's products are not listed.
James F. Pelletier, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... using reactive ion etching to define 3.1 µm deep chambers arrayed along a 100 µm wide by 22 µm deep channel defined by SU-8 photoresist (MicroChem). After treating with a silane release layer ...
-
No products found
because this supplier's products are not listed.
Maximilian Peer, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Initial crystallization screenings were carried out at 22°C by the sitting drop vapor diffusion method using the Phoenix HT liquid handling robot (Rigaku) to set up dual droplets for each condition with drop volume of 0.2 and 0.3 µl (1:1 and 2:1 ...
-
No products found
because this supplier's products are not listed.
Rachel Battaglia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and off-target analyses were performed as we described in detail previously in studies on AxD iPSC-astrocytes (22) with the addition of FGF-coated beads from StemCultures. Pluripotency was evaluated by the ThermoFisher Scorecard (56) ...
-
Cat# 82970-95-4,
Inquire
Ask
Thomas R. Lane, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (22) was purchased from BOC Sciences (Shirley NY). Favipiravir was purchased from AdooQ Bioscience (Irvine ...
-
No products found
because this supplier's products are not listed.
Kaijie Zheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The LC was run in a single column mode with an analytical column of a fused silica capillary (75 μm × 22 cm) with an integrated PicoFrit emitter (New Objective) packed in-house with Reprosil-Pur 120 C18-AQ 1.9 μm resin (Dr ...
-
No products found
because this supplier's products are not listed.
BE Floyd, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Plants were grown for seven days under long day conditions (16hr light/8hr dark) at 22°C on nutrient solid half-strength Murashige-Skoog medium with vitamins (MSP09; Caisson Labs), 1% sucrose ...
-
No products found
because this supplier's products are not listed.
James Pelletier, et al.,
bioRxiv - Cell Biology 2020
Quote:
18 and 22 mm square coverslips were passivated with poly-L-lysine covalently grafted to polyethylene glycol (PLL-g-PEG) (SuSoS #PLL(20)-g3.5-PEG(2) ...
-
No products found
because this supplier's products are not listed.
Francesco Di Nezio, et al.,
bioRxiv - Microbiology 2023
Quote:
Samples for transcriptomic analysis were filtered (Isopore 0.22 mm PC Membrane, diam 25 mm) using a vacuum pump (Vacuumbrand, Wertheim, Germany) connected to a filtration ramp (Pall, Basel, Switzerland) until the filter was completely clogged ...
-
No products found
because this supplier's products are not listed.
Brandon M Bensel, et al.,
bioRxiv - Biophysics 2023
Quote:
... Liposomes were then extruded to their final size of 350 nm diameter (22) through a 200 nm pore diameter extruder (T&T Scientific).
-
No products found
because this supplier's products are not listed.
Rafaela Schober, et al.,
bioRxiv - Immunology 2022
Quote:
... The pcDNA3.1 vector coding for human IL-15 was synthesized by ProteoGenix SAS (Strasbourg ...
-
No products found
because this supplier's products are not listed.
A.C. Geiger, et al.,
bioRxiv - Biophysics 2020
Quote:
... These fluorescently labeled molecules were solubilized in either 50/50 glyercol/water or in an aqueous solution of 22 mg/mL hyaluronic acid (15 MDa) purchased from Lifecore Biomedical (Chaska, MN). Solutions were mixed thoroughly prior to FRAP analysis.
-
No products found
because this supplier's products are not listed.
Bin Dong, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Three bandpass filters are used for the three PMTs for signal detection (FF01-509/22, Semrock, ET642/80m, Chroma Technology Corporation, and FF01-680/42, Semrock). The PMT output currents across all channels are converted to voltage and amplified using three preamplifiers (PMT4V3 ...
-
No products found
because this supplier's products are not listed.
Evan C. Ray, et al.,
bioRxiv - Physiology 2021
Quote:
... Urine Na+ and K+ excretion were measured via flame photometry (IL 943, Instrumentation Laboratory, Bedford, MA). The following day ...
-
No products found
because this supplier's products are not listed.
,
bioRxiv - Microbiology 2019
Quote:
... The 48 µl was then transferred to a sterile screw cap tube (Heathrow Scientific, Vernon Hills, IL) containing two 3 mm glass beads and 2 μl of bicoid inhibition control plasmid DNA (5 × 10−3 ng/μl).(27 ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-PP28 (EastCoast Bio), rabbit anti-GAPDH (Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Joseph de Rutte, et al.,
bioRxiv - Bioengineering 2021
Quote:
... antibody atezolizumab and the anti-interleukin 8 receptor beta (IL-8Rb) antibody 10H2 were cloned into the gwiz mammalian expression vector (Genlantis) and used for transient transfection of HEK 293T cells loaded into nanovials ...
-
No products found
because this supplier's products are not listed.
Kavita Rawat, et al.,
bioRxiv - Genomics 2023
Quote:
The predicted peptide sequence of the IL-6 and IL10 gene of CB cattle were developed using edit sequence (Lasergene Software, DNASTAR). Using Lasergene Software’s Megalign sequencing Programme (DNASTAR) ...
-
No products found
because this supplier's products are not listed.
Siyi Du, et al.,
bioRxiv - Bioengineering 2019
Quote:
... N-succinimidyliodoacetate (SIA), purchased from Pierce (Rockford, IL). Spectra/por® dialysis membrane (mol. wt. cut-off 50,000) was acquired from Spectrum Laboratories, Inc ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Valentin Greigert, et al.,
bioRxiv - Microbiology 2023
Quote:
... Crypt-a-glo TM (mouse mAb, Waterborne, Inc) was used at 1 drop per transwell ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
G. Vahidi, et al.,
bioRxiv - Microbiology 2022
Quote:
... The polishing procedure included 600 and 1200 grits of wet silicon carbide papers (Buehler, Lake Bluff, IL) followed by fine polishing with Rayon fine clothes (South Bay Technologies, San Clemente, CA) and a series of alumina suspensions (9 ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Probe DNA (mouse rDNA BAC clone RP23-225M6, Empire genomics) was mixed with Hybridization buffer (50% formamide ...
-
No products found
because this supplier's products are not listed.
Christopher Jonkergouw, et al.,
bioRxiv - Biochemistry 2023
Quote:
... dosed with LPS (50µl/mouse) using a P100 pipette (Gilson). The animals were held upright for a short period of time after dosing to allow for substance distribution down the respiratory tract ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse embryonic fibroblasts (MEFs) were cultured using DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Priyamvada Acharya, et al.,
bioRxiv - Immunology 2020
Quote:
... were captured using mouse anti-AVI-tag mAb (Avidity LLC, Aurora, CO). In brief ...
-
No products found
because this supplier's products are not listed.
Kyle Vaccaro, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cells were blocked with 100 ug/mL mouse IgG (Lampire Biological Laboratories) or Human TruStain FcX (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Zhenyue Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... each mouse was administrated the Sulfo-Cyanin-5.5-carboxylic-acid (Lumiprobe GmbH, Germany) fluorescent dye solution in PBS (50 µl ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Elin Palm, et al.,
bioRxiv - Microbiology 2023
Quote:
... MAB227P Monoclonal antibody to Norovirus (Mouse IgG2a κ, Clone 2002-G5, Maine Biotechnology Services), rabbit anti-Alexa Fluor 488-conjugated polyclonal IgG (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Karl A. Johnson, et al.,
bioRxiv - Biophysics 2020
Quote:
... we imaged a GFP labelled mouse brain sample acquired from SunJin Lab (Hsinchu City, Taiwan). This sample is a 250um thick coronal section which was cleared and mounted by SunJin Lab using the RapiClear 1.52 reagent.
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was anesthetized and placed into the RS 2000 Pro X-ray irradiator (Rad Source Technologies, Buford, GA, USA) to receive X-ray exposure (10 Gy ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
Teneale A. Stewart, et al.,
bioRxiv - Cell Biology 2019
Quote:
Free calcium concentrations in mouse milk were determined using a phenolsulphonephthalein reaction with the QuantiChrom Calcium Assay Kit (DICA-500, BioAssay Systems) as per manufacturer’s instructions and as previously reported in mouse milk samples (12).
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Sections of 5 μm from the paraffin embedded mouse tumors or slides of the lung adenocarcinoma tissue array (US Biomax, LC1504) were heated to 55°C for 20 min prior to deparaffinization in xylene (Fisher scientific ...
-
No products found
because this supplier's products are not listed.
Jinqiang Zhang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... for 24 h and the secondary antibodies (anti-rabbit IgG-conjugated Alexa Fluorochrome or anti-mouse IgG conjugated Alexa Fluorochrome, Invitrogen; 1:500) for 2 h at room temperature.