-
No products found
because this supplier's products are not listed.
Alice Melocchi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... with 5% AB human serum (Access Biologicals, UC-CA) and 1% L-glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Yongle Chen, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... were pretreated by overnight incubation at 37°C with a 10 µL mixture of 5 ng/µL dodecyl-beta-D-maltoside (DDM, J&K Scientific, China) and 1 ng/µL trypsin (Promega ...
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using a diamond knife (Histo HI 4317, Diatome). Afterwards sections were stained according to Gallyas52 and with Methylene blue/ Azur II for 1 min ...
-
No products found
because this supplier's products are not listed.
Larissa Kever, et al.,
bioRxiv - Microbiology 2021
Quote:
... coli Gyrase (HIS) Supercoiling Assay Kit (Inspiralis, Norwich, UK) using 1 U of the respective gyrases and the same Cg1978 concentrations as for the C.g ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Mateo I Sanchez, Alice Y Ting,
bioRxiv - Synthetic Biology 2019
Quote:
... 0.54 g/L CSM –Ade – His –Leu –Lys –Trp –Ura (Sunrise Science Products)) ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Gabrielle Brandt, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... recombinant human transferrin (InVitria), 80 μg/mL ...
-
No products found
because this supplier's products are not listed.
Jennifer Eng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Formalin-fixed paraffin-embedded (FFPE) human tissues were sectioned at 4-5 microns and mounted on positively charged slides (Tanner Adhesive Slides, Mercedes Medical, TNR WHT45AD). The slides were baked overnight at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Marta Fontcuberta-PiSunyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Human insulin was measured using a human Insulin ELISA kit (Crystal Chem, Zaandam, Netherlands) and C-peptide using a human C-peptide ELISA kit (Mercodia ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St. Charles, MO, USA). MMP-9 Duoset ELISA was obtained from R&D Systems ...
-
No products found
because this supplier's products are not listed.
Mohd Farid Abdul Halim, et al.,
bioRxiv - Microbiology 2023
Quote:
... maripaludis MM1265 or Δfdh1 Δfdh2 expressing fdh2-His were grown in 1-liter anaerobic Schott bottles (Chemglass) containing McCas-formate medium with a N2:CO2 (80:20 ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Darko Bosnakovski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Control LHCN-M2 immortalized human myoblasts 35 and FSHD (M008) immortalized human myoblasts were cultured in F10 medium (HyClone) with 20% FBS (Peak Serum), 2-mercaptoethanol 1x (Gibco) ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Madelon M.E. de Jong, et al.,
bioRxiv - Immunology 2023
Quote:
... slides were incubated with anti-human CD15 (1:10, C3D-1, Diagnostic BioSystems) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Mean-Hwan Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 350 µm thick human cortical slices were prepared using a Compressome VF-300 (Precisionary Instruments) or VT1200S (Leica Biosystems) ...
-
No products found
because this supplier's products are not listed.
Mahmoud Suliman, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Dialysis was performed against deionized water using Spectra/Por 3 dialysis membrane tubing (Repligen) with a MWCO of 3.5 kDa for 48 hours ...
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV 3CLpro complex with compound 5: Berkeley screen (Rigaku Reagents) condition B1 (30% (w/v ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2023
Quote:
Modified Hoagland’s solution imaging gels solidified with 5% Gelzan™ (Caisson Labs, UT, USA) were prepared for the root imaging experiments ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Cory Schwarz, et al.,
bioRxiv - Microbiology 2022
Quote:
... plus 5% defibrinated horse blood in fastidious anaerobe agar (FAA) (Neogen, Lansing, MI, United States). When growth was visible on the plates ...