-
No products found
because this supplier's products are not listed.
Barbara D. Fontana, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... Cortisol levels were assessed using a human salivary cortisol ELISA kit (Salimetrics) as previously described (Cachat et al. ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Vladimir Majerciak, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 ×105 cells seeded in a 6-well plate were transfected with 40 nM SMARTpool human siRNAs (Horizon) or non-targeting (siNT) control siRNA (Horizon) using LipoJet In Vitro Transfection Kit (Ver. II) (SignaGen Laboratories). Twenty-four hours after the first transfection ...
-
No products found
because this supplier's products are not listed.
Dawn M. Fernandez, et al.,
bioRxiv - Immunology 2019
Quote:
... All antibodies used for CITE-seq were conjugated at the Human Immune Monitoring Core at Mount Sinai using ThunderLink Plus conjugation kits (Expedeon, Cat#425-0000), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Yan Wang, Meiling Lian, Liping Song, Shengzhou Wu,
bioRxiv - Neuroscience 2020
Quote:
... fractions using commercially available kits (Cat#CSB-E08299h for human Aβ40; Cat#CSB-E10684h for human Aβ42, CUSABIO TECHNOLOGY LLC, Wuhan, China) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
This product is a CLIA kit for the in vitro determination of Human CD154 in the samples of...
Cat# NGK-271,
1.0 case, Inquiry
Ask
Christopher J. Minteer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
3 primary human astrocyte cell lines were derived from the cerebral cortex of one 21-year-old male donor (Creative Biolabs, #NCL-2103-P104). The 21M donor was split into Astro1 ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Balaji Karthick Subramanian, et al.,
bioRxiv - Pathology 2019
Quote:
... Human primary podocytes from Celprogen Inc ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
FITC conjugated recombinant human KIT (P10721-1) (Val50-Gln190), fused with a polyhistidine tag...
Cat# KIT-396HF,
50ug , USD $1298
Ask
Noah R. Johnson, et al.,
bioRxiv - Neuroscience 2021
Quote:
... recombinant human apoA-I (Creative Biomart), human plasma-derived apoE (Sigma) ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
Eun Young Jeong, et al.,
bioRxiv - Biochemistry 2024
Quote:
... human preadipocytes were seeded in 12-well plates (Cellvis) and cultured to confluency ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Qinghui Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... Naïve CD3 human T cells were purchased from HemaCare (Lot #21068415). N/TERT-1 cells were a gift from the Rheinwald Lab (Dickson et al. ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... Human B cell proliferation was measured by 3[H]-thymidine incorporation (1 μCi/mL) (American Radiolabeled Chemicals).
-
No products found
because this supplier's products are not listed.
Syed Moiz Ahmed, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Endogenous TOP1cc were detected by Human Topoisomerase ICE kit (Topogen, TG1020-0) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Min Pan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cas9 activity was tested using the CRISPRtest™ Functional Cas9 Activity Kit for Human Cells (Cellecta, #CRTEST). The clone with normal viability and high Cas9 activity (> 95% ...
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and levels of the IgG1 Fc moiety were measured by Human IgG ELISA Kit (Immunology Consultants Laboratory). To characterize different routes side-by-side ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Manuel Göpferich, et al.,
bioRxiv - Neuroscience 2020
Quote:
... human FGF (20 ng/μl, ReliaTech) and human EGF (Promokine) ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Huu Tuan Nguyen, et al.,
bioRxiv - Bioengineering 2023
Quote:
Human umbilical vein endothelial cells (ECs, Angio-Proteomie, MA, USA) were cultured in Vasculife (LifeLine Cell Technology ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...