-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... recombinant human epidermal growth factor (hEGF, 20 ng/ml, Chimerigen Laboratories, CHI-HF-210EGF), recombinant human platelet derived growth factor (hPDGF-AB ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Cryopreserved human Kupffer cells (Samsara Sciences) and human Stellate cells (IXCells) were thawed according to their respective vendor/Emulate protocols on the day of seeding ...
-
No products found
because this supplier's products are not listed.
Yunxia Tang, et al.,
bioRxiv - Immunology 2019
Quote:
Human IFN-γ ELISPOT assays were performed by ELISPOT kit (Mab Tech). The plates were washed three times with PBS ...
-
No products found
because this supplier's products are not listed.
A Elgheznawy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... detecting activated αIIbβ3 integrin and FITC-coupled anti-P-selectin (Wug.E9, Emfret Analytics) antibodies in the dark ...
-
No products found
because this supplier's products are not listed.
Sune Schubert, et al.,
bioRxiv - Biochemistry 2022
Quote:
... tBu-T-OH was purchased from Enamine Ltd (NJ ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Kai Sha, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Human cell lines were incubated with antibodies against CD166-FITC (3A6; Ancell, Stillwater, MN; 1:1250) and CD49f-Alexa Fluor® 647 (GoH3 ...
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... we incubated the lungs for 30 minutes with a biotinylated anti-H3N2 influenza viral particle antibody in T cell culture medium (ViroStat, Cat#: 1317), followed by washing and staining with Streptavidin Alexa Fluor 555 (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Rania Francis, et al.,
bioRxiv - Microbiology 2019
Quote:
Two cell lines were used as cellular supports for co-culture: the human embryonic lung fibroblast MRC5 cells (RD-Biotech, Besançon, France) and the mouse fibroblast L929 cells (ATCC® CCL-1) ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Marie-Claire Dagher, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Thrombin generation was triggered by 1pM tissue factor and 4μM phospholipids (PPP-reagent low, Diagnostica Stago) in the presence of a fluorogenic substrate (FluCa kit) ...
-
No products found
because this supplier's products are not listed.
Marisa Oliveira, et al.,
bioRxiv - Immunology 2020
Quote:
... P/S and 25 ng/ml recombinant chicken colony stimulating factor 1 (CSF-1) (Kingfisher Biotech, Inc) at 41 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Bruno Rafael Barboza, et al.,
bioRxiv - Microbiology 2023
Quote:
... and incubated with primary antibodies: mouse anti-cardiac troponin T (HyTest clone 4T19/2) and rabbit anti-α-actinin (Millipore ...
-
No products found
because this supplier's products are not listed.
Morgane Batzenschlager, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The p35S::CYCD3;1-HA construct was co-transformed with binary vectors allowing native expression of cell cycle regulated-reporters (pH4::GUS, pKNOLLE::GUS, pKNOLLE::eGFP-KNOLLE) and constitutive expression of transcription factors (NF-YA1, NF-YA1mutDBD) from Medicago. All plasmids used in the experiments involving the CDEL system are listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Human umbilical vein ECs (HUVECs) obtained from VEC Technologies were cultured in M199 media supplemented with 20% FBS ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Kristin M. Snyder, et al.,
bioRxiv - Immunology 2020
Quote:
... MEDI3622 was generated as a human IgG1 by Syd Labs (Natick, MA) using its variable heavy and variable light chain sequences ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV 3CLpro complex with compound 5: Berkeley screen (Rigaku Reagents) condition B1 (30% (w/v ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Gerda E. Breitwieser, et al.,
bioRxiv - Neuroscience 2023
Quote:
WT GPR37L1 and variants (without or with the Glu-Glu tag) were transfected into GPR37L1-KO SK cells (SK-N-MC Transfection Kit, Altogen Biosystems). Cells were lysed after 48 hours ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Michael Jewer, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cells were cultured in a bioreactor (Synthecon) as previously described56.
-
No products found
because this supplier's products are not listed.
Thomas F. Martinez, et al.,
bioRxiv - Genomics 2019
Quote:
... Fluorescein-labeled reference peptide KVFPC(FITC)ALINK was synthesized by covalently coupling of fluorescein to the cysteine residue with 5-(iodoacetamido)fluorescein (Marker Gene Technologies, M0638) for use in the HLA-binding assay ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Aron Broom, et al.,
bioRxiv - Biophysics 2020
Quote:
... crystals were mounted in polyimide loops and sealed using a MicroRT tubing kit (MiTeGen). Single-crystal X-ray diffraction data was collected on beamline 8.3.1 at the Advanced Light Source ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Fernando R. Balestra, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Ultra-thin (50 nm thick) serial sections were cut through the entire cell with a diamond knife (Diatome) and ultramicrotome (Leica Microsystems ...
-
No products found
because this supplier's products are not listed.
Ho-Shiang Huang, Chan-Jung Liu,
bioRxiv - Biochemistry 2021
Quote:
Commercial kits were used to determine the urine level of NGAL (NGAL ELISA Kit, BioPorto Diagnostics A/S, Copenhagen, Denmark) and the urine levels of stone-induced renal tubular damage markers ...
-
No products found
because this supplier's products are not listed.
Vincent Mouilleau, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SA001 embryonic stem cell (ESC) line (male, RRID: CVCL_B347) was obtained from Cellectis and used accordingly to the French current legislation (Agency of Biomedicine ...
-
No products found
because this supplier's products are not listed.
Romain Lanotte, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Cells were then transiently transfected with 5 μg of each construct using Metafectene (Biontex Lab.; München, Germany), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Robin Mesnage, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Cells were exposed to five concentrations of the test samples in the absence and presence of 0.25% S9 extract and required co-factors (RegenSysA+B, Moltox) for 24 h ...
-
No products found
because this supplier's products are not listed.
Kaushik Inamdar, et al.,
bioRxiv - Biophysics 2021
Quote:
... rabbit polyclonal anti human ALIX (Covalab – pab 0204).
-
No products found
because this supplier's products are not listed.
Takahiro Sanada, et al.,
bioRxiv - Microbiology 2022
Quote:
... AB human serum (Pel-Freez Biologicals, Rogers, AR, USA) was used as control serum.
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... A previously reported (16,54) human GPR37L1 was purchased from Multispan; however ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Tamara A. Potapova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Fluorescein-labeled probe for human rDNA (BAC clone RP11-450E20) was obtained from Empire Genomics (Buffalo, NY). Specimens and the probe were denatured together for 7 min at 85°C and hybridized under HybriSlip hybridization cover (GRACE Biolabs ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...