-
No products found
because this supplier's products are not listed.
Alice Melocchi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... with 5% AB human serum (Access Biologicals, UC-CA) and 1% L-glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... RAFT chain transfer agents 2-cyano-2-propyl dodecyl trithiocarbonate (2-CPDT; Strem Chemicals, >97%) and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433 ...
-
No products found
because this supplier's products are not listed.
John Campbell McNamara, et al.,
bioRxiv - Physiology 2022
Quote:
... The muscle fragments were placed in previously weighed Eppendorf microtubes (MT) and weighed immediately on an electronic analytical balance (Ohaus Analytical Plus AP250D ...
-
No products found
because this supplier's products are not listed.
Karine Queiroz Zetune Villa Real, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and residual IgG1 were further removed by incubating the pooled sample with agarose beads conjugated with anti-llama light chain (Capralogics).
-
No products found
because this supplier's products are not listed.
Jeremy P. Goering, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Tissue sections were incubated in primary antibodies KI-67 (CST, 12202) 1:500 and phospho-Myosin Light Chain Ser-1 (ECM Biosciences, MP3461) 1:100 overnight at 4°C then washed in PBS three times for 10 minutes each ...
-
No products found
because this supplier's products are not listed.
Darko Bosnakovski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Control LHCN-M2 immortalized human myoblasts 35 and FSHD (M008) immortalized human myoblasts were cultured in F10 medium (HyClone) with 20% FBS (Peak Serum), 2-mercaptoethanol 1x (Gibco) ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-human TFAM (1:1000, PhosphoSolutions, Catalog# 1999-hTFAM), Anti-mouse TFAM (1:1000 ...
-
No products found
because this supplier's products are not listed.
Takahiro Sanada, et al.,
bioRxiv - Microbiology 2022
Quote:
... AB human serum (Pel-Freez Biologicals, Rogers, AR, USA) was used as control serum.
-
No products found
because this supplier's products are not listed.
Ayat Zawawi, et al.,
bioRxiv - Immunology 2019
Quote:
... The level of endotoxin in all the purified VLPs was measured with an ELISA-based endotoxin detection assay (Hyglos) following the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... A previously reported (16,54) human GPR37L1 was purchased from Multispan; however ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Masaya Matsubayashi, et al.,
bioRxiv - Biochemistry 2019
Quote:
The human hepatocellular carcinoma cell HepG2 was purchased from Cellular Engineering Technologies ...
-
No products found
because this supplier's products are not listed.
Kyle E. Landgraf, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Human PBMC stimulation and immune-phenotyping studies were performed by iQ Biosciences. Briefly normal PBMCs from three donors were seeded in 96-well plates at 1×105 cells/well and exposed to a 10-fold dilution series of either U2S3-hFc-mutIL2 or U2S3-hFc-wtIL2 (wild-type IL2 ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Erdem D. Tabdanov, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human CD4+ T cells were plated on a glass-bottom dish (Willco Wells) pre-coated with either ICAM-1 (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Ghulam Destgeer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... particles were incubated with varying concentrations of human recombinant NT-proBNP (HyTest, Finland) for 1 hr with subsequent washing ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Ashley F. Melnick, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human and murine T-ALL cells were treated at increasing doses of berzosertib (Chemietek) for 9-10 days ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A surgical sterile sponge soaked in 5% fluorogold (Fluorochrome, LLC) in sterile saline was deposit at the site of the nerve cut to enable visualization of injured motor neurons post-injury ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Tamara A. Potapova, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Fluorescein-labeled probe for human rDNA (BAC clone RP11-450E20) was obtained from Empire Genomics (Buffalo, NY). Specimens and the probe were denatured together for 7 min at 85°C and hybridized under HybriSlip hybridization cover (GRACE Biolabs ...
-
No products found
because this supplier's products are not listed.
Jack George, Howard T. Jacobs,
bioRxiv - Molecular Biology 2019
Quote:
... Membranes were blocked in 5% nonfat milk in PBS-0.05% Tween (Medicago) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Alexandre Champroux, et al.,
bioRxiv - Genetics 2023
Quote:
... each 35.5 cm long and 5 cm wide (Campden Instruments Ltd, Lafayette, IN). General mouse activity was analyzed for 5 min ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Yunwei Lu, et al.,
bioRxiv - Systems Biology 2024
Quote:
We performed eY1H assays using a human TF yeast array (15) as previously described and as follows using a high-density array ROTOR robot (Singer Instruments). The three-plate human TF yeast array and promoter yeast strains were mated pairwise on permissive media agar plates and incubated at 30°C for 1 day ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Kathleen E. DelGiorno, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... slides were stained using a kit (IHC world) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2023
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-5) in RPMI 1640 1 % FBS ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Clotilde Laussel, et al.,
bioRxiv - Genetics 2022
Quote:
... The assay was performed using the 2DG uptake measurement kit (Cosmo Bio USA, Carlsbad ...
-
No products found
because this supplier's products are not listed.
Misato Okamoto Miyakawa, Hitoshi Miyakawa,
bioRxiv - Evolutionary Biology 2022
Quote:
... Samples were prepared using a CyStain UV Precise P Kit (Sysmex Partec., GmbH.). Each body ...
-
No products found
because this supplier's products are not listed.
Cassandra Velasco, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PCR master mixes were decontaminated with double-stranded DNAse treatment (PCR decontamination kit, Arcticzymes, Tromsø, Norway). Sterile water was processed using the same procedure as a negative control ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Concepcion Manzano, et al.,
bioRxiv - Plant Biology 2022
Quote:
... RNA was extracted with the Direct-zol RNA MiniPrep Plus kit (Neta Scientific Cat no RPI-ZR2053). cDNA libraries were made with the QuantSeq 3′ mRNA-Seq Library Prep kit from Lexogen (Cat no 015 QuantSeq FWD 3’ mRNA-Seq Library Prep Kit – with single indexing) ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...