-
No products found
because this supplier's products are not listed.
Qian Shi, et al.,
bioRxiv - Physiology 2022
Quote:
... anti-Phospholamban (PLB-pThr17) (A010-13, Badrilla), and anti-Phospholamban (PLB ...
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
No products found
because this supplier's products are not listed.
Ankita M. George, et al.,
bioRxiv - Microbiology 2021
Quote:
Sequences were assembled in SeqMan Pro 13 (DNASTAR). Assembled sequences were compared through the using BLASTn (NCBI ...
-
No products found
because this supplier's products are not listed.
Dan Luo, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Obesity was induced in male C57BL/6N mice (age, 3-4 weeks; body weight, 11-13 g) by feeding on 60 kcal% HFD (Research Diets, Inc, New Brunswick, NJ, USA) for 12 weeks before the experiments ...
-
No products found
because this supplier's products are not listed.
Jennifer Nill, Tina Jeoh,
bioRxiv - Bioengineering 2020
Quote:
... The pAPC column matrix was synthesized using commercially available pAPC (Carbosynth). Purity of the final Cel7A preparation was identified by a single band in an SDS-PAGE at ∼65 kDA and the identity of Cel7A was verified by LC/MS/MS at the proteomics facility at University of California ...
-
No products found
because this supplier's products are not listed.
Akanksha Thawani, et al.,
bioRxiv - Cell Biology 2020
Quote:
... An objective heater collar was attached (Bioptechs, model 150819-13) and the temperature set-point of 33.5°C was used for experiments ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Zak Frentz, Jonathan Dworkin,
bioRxiv - Biophysics 2020
Quote:
... through sterile tubing (Cole-Parmer, C-Flex #13, i.d. 0.8 mm), into the perfusion chamber ...
-
No products found
because this supplier's products are not listed.
Valentin Roustan, et al.,
bioRxiv - Plant Biology 2019
Quote:
... polyclonal rabbit anti-actin antibody (#AS 13 2640, Agrisera, Vännäs, Sweden), dilution 1:50 ...
-
No products found
because this supplier's products are not listed.
Seung Jae Shin, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 100 ng/mL Phorbol 12-myristate 13-acetate (PMA; BioGems, #1652981) was added ...
-
No products found
because this supplier's products are not listed.
Barbara D. Fontana, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... Cortisol levels were assessed using a human salivary cortisol ELISA kit (Salimetrics) as previously described (Cachat et al. ...
-
No products found
because this supplier's products are not listed.
Sophie Vieweg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used a caspaTag fluorescein caspase 3 activity kit (ImmunoChemistry Technologies, MN, USA), which allows the detection of active effector caspase (caspase 3 ...
-
No products found
because this supplier's products are not listed.
Junfei Xia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The sensors were carefully introduced into a microdialysis hollow fiber (13 kDa, Spectrum Laboratories) via capillary action ...
-
No products found
because this supplier's products are not listed.
M.F. Koloski, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Tissue was blocked in the flat skull position using a brain matrix (RWD Life Science Inc., CA, USA). Brains with field potential probes were sectioned frozen in the coronal plane at 50μm thick ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Wild-type Chinese hamster ovary (WT CHO) and CHO 13-5-1 cells (FitzGerald et al., 1995) were maintained in DMEM/Ham’s F12 with L-glutamine (DMEM/F12 ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Yang-Hee Kim, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the demineralized bone matrix (DBM) fragments were ground using a homogenizer (T10 basic Ultra-turrax, IKA LTD, Oxford, UK). The powders went passed through stainless steel sieves with 45 ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Cora C. Hart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
Picrosirius Red (PSR) staining was performed as previously described (13) following decalcification of muscle sections using Formical-2000 (StatLab). Slides were visualized with a Leica DMR microscope ...
-
No products found
because this supplier's products are not listed.
Oliver Arnolds, Raphael Stoll,
bioRxiv - Biophysics 2022
Quote:
... 1.4 M ammonium sulfate was added and then applied to a hydrophobic interaction chromatography column with a Toyopearl Butyl-650S-substituted matrix (Tosoh Bioscience) using a peristaltic pump ...
-
No products found
because this supplier's products are not listed.
Vladimir Majerciak, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 ×105 cells seeded in a 6-well plate were transfected with 40 nM SMARTpool human siRNAs (Horizon) or non-targeting (siNT) control siRNA (Horizon) using LipoJet In Vitro Transfection Kit (Ver. II) (SignaGen Laboratories). Twenty-four hours after the first transfection ...
-
No products found
because this supplier's products are not listed.
Sk. Kayum Alam, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human DARPP-32 isoforms purified from NSCLC cells were incubated with kinase-activated human IKKα protein (SignalChem) for in vitro kinase assays by following previously described methods70 ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Michael J. Ricciardi, et al.,
bioRxiv - Immunology 2022
Quote:
... Briefly, samples were snap-frozen in lysing matrix tubes (MP Bio, Cat# 116913050-CF) soaked in 1 mL Trireagent (Molecular Research Center, Catalog# RN190) and homogenized at 4000 rpm for 30 seconds in a Bead BugTM microtube homogenizer (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Mutsumi Kobayashi, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Human iPSCs were dissociated using Accutase (Innovative Cell Technologies, AT104) and suspended in mTeSR plus (Stemcell Technologies ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Azaz Ahmed, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... extra-cellular matrix precoated flasks (Celprogen, USA; 35002-04-T75) and cultured in complete growth medium with serum (Celprogen ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and digested by Collagenase NB4 (Nordmark Biochemicals, S1745402) at 2 PZU / 100 mg tissue ...
-
No products found
because this supplier's products are not listed.
Frances M. Bashore, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 13 (PubChem ID: 24337874) was purchased from Enamine (Vendor ID: Z56176033). Compounds 2 – 41 were purchased from ChemDiv ...
-
No products found
because this supplier's products are not listed.
Yan Wang, Meiling Lian, Liping Song, Shengzhou Wu,
bioRxiv - Neuroscience 2020
Quote:
... fractions using commercially available kits (Cat#CSB-E08299h for human Aβ40; Cat#CSB-E10684h for human Aβ42, CUSABIO TECHNOLOGY LLC, Wuhan, China) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
Eun Young Jeong, et al.,
bioRxiv - Biochemistry 2024
Quote:
... human preadipocytes were seeded in 12-well plates (Cellvis) and cultured to confluency ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Qinghui Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... Naïve CD3 human T cells were purchased from HemaCare (Lot #21068415). N/TERT-1 cells were a gift from the Rheinwald Lab (Dickson et al. ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...