-
No products found
because this supplier's products are not listed.
Alice Melocchi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... with 5% AB human serum (Access Biologicals, UC-CA) and 1% L-glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Aadra P. Bhatt, et al.,
bioRxiv - Microbiology 2024
Quote:
... lamblia (assemblage B, H3 cysts) were acquired from Waterborne, Inc and as previously described9 ...
-
No products found
because this supplier's products are not listed.
Ho-Shiang Huang, Chan-Jung Liu,
bioRxiv - Biochemistry 2021
Quote:
Commercial kits were used to determine the urine level of NGAL (NGAL ELISA Kit, BioPorto Diagnostics A/S, Copenhagen, Denmark) and the urine levels of stone-induced renal tubular damage markers ...
-
No products found
because this supplier's products are not listed.
Tamás Bakos, et al.,
bioRxiv - Immunology 2024
Quote:
... Soluble terminal C complex (sTCC, sC5b9) was measured with an ELISA kit from Svar Life Science AB (Malmö ...
-
No products found
because this supplier's products are not listed.
Yunxia Tang, et al.,
bioRxiv - Immunology 2019
Quote:
Human IFN-γ ELISPOT assays were performed by ELISPOT kit (Mab Tech). The plates were washed three times with PBS ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
Cat# F101,
USD $80.00/EA
Ask
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
No products found
because this supplier's products are not listed.
Shaun M. Christie, et al.,
bioRxiv - Biophysics 2021
Quote:
... Recombinant human Semaphorin 3A (CX65, Bon Opus Biosciences, Milburn, NJ) contains residues 21-771 and is >95% pure ...
-
No products found
because this supplier's products are not listed.
Livia Mazzini, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 1µg/mL of purified recombinant Spike S1 Protein (aa 18-676) (eEnzyme, Gaithersburg, MD, USA) or with 1µg/mL Spike-RBD (Arg319-Phe541 ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-fluorotryptamine hydrochloride (AstaTech, Catalog #52030), 6-fluorotryptamine (AstaTech ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Catherine D. Stark, et al.,
bioRxiv - Biochemistry 2021
Quote:
The KSI substrate 5(10)-estrene-3,17-dione (5(10)EST) was purchased from Steraloids (Newport, RI). Reactions of purified KSIs with 5(10)EST were monitored continuously at 248 nm using a Perkin Elmer Lambda 25 UV/Vis spectrometer with an attached VWR digital temperature controlled circulating water bath (Pinney et al. ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
Recombinant Antigen
Cat# REC31719-100,
100µg USD $503.0
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Tobie D. Lee, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... R-5 cells were incubated in a similar fashion except 5 μM pheophorbide A (PhA, Frontier Scientific, Logan, UT) was used as the substrate and 10 μM fumitremorgin C (FTC ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Shijian Zhang, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... resuspended in 1×PBS to a final concentration of 5 mg of wet membrane per ml of 1×PBS and crosslinked with 5 mM BS3 (Proteochem), followed by solubilization with a solubilization buffer containing 100 mM (NH4)2SO4 ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
Maximin H3 shows antibacterial activity against both Gram-positive and Gram-negative bacteria....
Cat# BAT-012021,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Valentin Mitterer, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Growth phenotypes of the mutant alleles were analysed on plates containing 1 g/l 5-fluoroorotic acid (5-FOA) (Apollo Scientific, Cat# PC4054) to select for cells that have lost the wild-type SPB4-containing URA3 plasmid ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled A*0201 dextramer negative control (Immudex, 1:5). Antibodies for western blot ...
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV 3CLpro complex with compound 5: Berkeley screen (Rigaku Reagents) condition B1 (30% (w/v ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which a 5 mL glass serum vial (DWK Life Sciences, New Jersey ...
-
No products found
because this supplier's products are not listed.
Alina Sigaeva, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human colon adenocarcinoma HT-29 cells were routinely cultured in Dulbecco’s Modified Eagle’s Medium (Cellutron Life Technologies, USA) with a high glucose concentration ...
-
No products found
because this supplier's products are not listed.
Hsiao-Jou Cortina Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... filtered and incubated with 5 mL PureCube Ni-NTA agarose (Cube Biotech) for 1 h at 21°C ...
-
No products found
because this supplier's products are not listed.
Shannon J. McKie, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Topo VI (5-80 nM) was incubated with 2.5 nM negatively supercoiled pBR322* (Inspiralis) in a 30 μL reaction volume with Cleavage Buffer (20 mM Bis-Tris propane (pH 7) ...
-
No products found
because this supplier's products are not listed.
Katrin Manske, et al.,
bioRxiv - Bioengineering 2023
Quote:
20,000 Human Embryonic Kidney cells (HEK293-CD19+) expressing the CD19 antigen were seeded on a 96-well E-plate (ACEA Biosciences) over night ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... zebrafish were incubated for 5 min at 28.5°C with optovin 6b8 (ID 5705191l; ChemBridge), an optovin analog (Kokel et al. ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Qiang Li, et al.,
bioRxiv - Genomics 2021
Quote:
... were first treated with oxygen plasma for 5 mins (Anatech Barrel Plasma System, 100W, 40% O2) followed by methacryloxypropyltrimethoxysilane (Bind-Silane ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... slides were incubated in 95% ethanol for 5 min and counterstained with Eosin (Poly Scientific S1761GL) for 1-3 min ...
-
No products found
because this supplier's products are not listed.
Irene P. Ayuso-Jimeno, et al.,
bioRxiv - Neuroscience 2021
Quote:
Mice were anesthetized with 5% isoflurane and subsequently head fixed in a stereotaxic frame (RWD Life Science) with body temperature maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Gustavo W. Fernandes, et al.,
bioRxiv - Physiology 2020
Quote:
In vivo transfections were performed with a liver transfection kit (Altogen Biosystems), as previously described (Fernandes et al. ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Maggie R. Wagner, et al.,
bioRxiv - Plant Biology 2020
Quote:
... We used the Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics, Lebanon, NJ, USA) to purify DNA ...
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
... PTX3 and CCL2 staining was amplified by Tyramide Signal Amplification kit (TSATM, NENTM Life Science Products). Tissue was first blocked with TNB (Tris-NaCl-blocking buffer) ...